Result : O07593
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Uncharacterized protein YhdX |
| NCBI Accession ID | Y14082.1 |
| Organism | Bacillus subtilis (strain 168) |
| Left | 25281 |
| Right | 25388 |
| Strand | + |
| Nucleotide Sequence | ATGGGAAAAGGGAGAATCAGAGTGGAGGAAAGAATTAAAGCCGAAACGGATGCTGAAATGCAAAAAGCAACTCTCCTTGATCAGACACAAACGAAAAAAGGTAAGTGA |
| Sequence | MGKGRIRVEERIKAETDAEMQKATLLDQTQTKKGK |
| Source of smORF | Swiss-Prot |
| Function | The ORF matches to the profile of pfam17444. Profile Description: Uncharacterized protein YhdX. This is a family of unknown function found in Bacillus. |
| Pubmed ID | 9579061 9384377 |
| Domain | CDD:340159 |
| Functional Category | Others |
| Uniprot ID | O07593 |
| ORF Length (Amino Acid) | 35 |
++ More..
| Conservation Analysis |
No. of Species: 16
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1038653 | 1038760 | + | NC_000964.3 | Bacillus subtilis subsp. subtilis str. 168 |
| 2 | 1011109 | 1011216 | + | NZ_CP034943.1 | Bacillus subtilis subsp. spizizenii ATCC 6633 = JCM 2499 |
| 3 | 1218729 | 1218836 | + | NZ_CP033052.1 | Bacillus vallismortis |
| 4 | 970829 | 970936 | + | NZ_CP048852.1 | Bacillus tequilensis |
| 5 | 1022932 | 1023039 | + | NZ_CP013984.1 | Bacillus inaquosorum |
| 6 | 953814 | 953921 | - | NZ_CP029364.1 | Bacillus halotolerans |
| 7 | 1042454 | 1042558 | + | NZ_CP051464.1 | Bacillus mojavensis |
| 8 | 964307 | 964411 | + | NZ_CP053376.1 | Bacillus amyloliquefaciens |
| 9 | 2982457 | 2982561 | - | NZ_CP011937.1 | Bacillus velezensis |
| 10 | 543410 | 543511 | - | NZ_CP043404.1 | Bacillus safensis |
| 11 | 951261 | 951362 | + | NZ_CP011150.1 | Bacillus altitudinis |
| 12 | 1125957 | 1126064 | + | NZ_CP023665.1 | Bacillus paralicheniformis |
| 13 | 1035364 | 1035471 | + | NC_006270.3 | Bacillus licheniformis DSM 13 = ATCC 14580 |
| 14 | 678988 | 679089 | - | NZ_CP017786.1 | Bacillus xiamenensis |
| 15 | 1101188 | 1101283 | + | NZ_LT603683.1 | Bacillus glycinifermentans |
| 16 | 3355034 | 3355132 | - | NZ_CP016020.1 | Bacillus weihaiensis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000964.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01595.22 | 0.75 | 12 | 1715.0 | same-strand | Cyclin M transmembrane N-terminal domain |
| 2 | PF03471.19 | 0.75 | 12 | 1715.0 | same-strand | Transporter associated domain |
| 3 | PF00571.30 | 0.75 | 12 | 1715.0 | same-strand | CBS domain |
| 4 | PF02537.17 | 0.94 | 15 | 1155.5 | opposite-strand | CrcB-like protein, Camphor Resistance (CrcB) |
| 5 | PF03009.19 | 0.94 | 15 | 234 | opposite-strand | Glycerophosphoryl diester phosphodiesterase family |
| 6 | PF00924.20 | 0.94 | 15 | 161 | same-strand | Mechanosensitive ion channel |
| 7 | PF02146.19 | 0.94 | 15 | 1331 | same-strand | Sir2 family |
| 8 | PF01522.23 | 0.94 | 15 | 2110 | opposite-strand | Polysaccharide deacetylase |
| 9 | PF01063.21 | 0.88 | 14 | 3238.5 | same-strand | Amino-transferase class IV |
++ More..