Result : O07226
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Toxin Rv0299 |
| NCBI Accession ID | AL123456.3 |
| Organism | Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) |
| Left | 363476 |
| Right | 363778 |
| Strand | + |
| Nucleotide Sequence | TTGATCGCTCCCGGCGACATCGCGCCGCGCCGCGACAGTGAACACGAGCTCTACGTCGCCGTCTTGTCCAACGCGCTCCATCGGGCCGCGGACACCGGACGGGTGATCACCTGCCCATTCATTCCGGGCCGGGTCCCCGAGGATCTCTTGGCGATGGTGGTGGCGGTCGAGCAACCCAACGGCACGCTGCTGCCGGAACTCGTGCAGTGGCTTCATGTTGCCGCGCTCGGTGCGCCACTCGGCAACGCGGGCGTGGCCGCCCTACGCGAGGCTGCCTCGGTCGTGACAGCTCTGCTCTGTTAG |
| Sequence | MIAPGDIAPRRDSEHELYVAVLSNALHRAADTGRVITCPFIPGRVPEDLLAMVVAVEQPNGTLLPELVQWLHVAALGAPLGNAGVAALREAASVVTALLC |
| Source of smORF | Swiss-Prot |
| Function | Toxic component of a type II toxin-antitoxin (TA) system. Upon expression in M.smegmatis inhibits colony formation. Its toxic effect is neutralized by coexpression with cognate antitoxin Rv0298/MT0312. {ECO:0000269|Pubmed:20011113}. |
| Pubmed ID | 9634230 20011113 21969609 |
| Domain | |
| Functional Category | Toxin_type_2 |
| Uniprot ID | O07226 |
| ORF Length (Amino Acid) | 100 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 363476 | 363778 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 2 | 4660088 | 4660390 | - | NZ_AP022581.1 | Mycobacterium lacus |
| 3 | 58040 | 58339 | + | NZ_LR134355.1 | Mycolicibacterium chitae |
| 4 | 2884481 | 2884783 | + | NZ_AP022605.1 | Mycobacterium doricum |
| 5 | 5014296 | 5014601 | - | NZ_AP022614.1 | Mycobacterium parmense |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000962.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01402.23 | 1.0 | 5 | -3 | same-strand | Ribbon-helix-helix protein, copG family |
++ More..