Protein Information |
Information Type | Description |
---|---|
Protein name | Toxin Rv0299 |
NCBI Accession ID | AL123456.3 |
Organism | Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) |
Left | 363476 |
Right | 363778 |
Strand | + |
Nucleotide Sequence | TTGATCGCTCCCGGCGACATCGCGCCGCGCCGCGACAGTGAACACGAGCTCTACGTCGCCGTCTTGTCCAACGCGCTCCATCGGGCCGCGGACACCGGACGGGTGATCACCTGCCCATTCATTCCGGGCCGGGTCCCCGAGGATCTCTTGGCGATGGTGGTGGCGGTCGAGCAACCCAACGGCACGCTGCTGCCGGAACTCGTGCAGTGGCTTCATGTTGCCGCGCTCGGTGCGCCACTCGGCAACGCGGGCGTGGCCGCCCTACGCGAGGCTGCCTCGGTCGTGACAGCTCTGCTCTGTTAG |
Sequence | MIAPGDIAPRRDSEHELYVAVLSNALHRAADTGRVITCPFIPGRVPEDLLAMVVAVEQPNGTLLPELVQWLHVAALGAPLGNAGVAALREAASVVTALLC |
Source of smORF | Swiss-Prot |
Function | Toxic component of a type II toxin-antitoxin (TA) system. Upon expression in M.smegmatis inhibits colony formation. Its toxic effect is neutralized by coexpression with cognate antitoxin Rv0298/MT0312. {ECO:0000269|Pubmed:20011113}. |
Pubmed ID | 9634230 20011113 21969609 |
Domain | |
Functional Category | Toxin_type_2 |
Uniprot ID | O07226 |
ORF Length (Amino Acid) | 100 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 363476 | 363778 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
2 | 4660088 | 4660390 | - | NZ_AP022581.1 | Mycobacterium lacus |
3 | 58040 | 58339 | + | NZ_LR134355.1 | Mycolicibacterium chitae |
4 | 2884481 | 2884783 | + | NZ_AP022605.1 | Mycobacterium doricum |
5 | 5014296 | 5014601 | - | NZ_AP022614.1 | Mycobacterium parmense |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF01402.23 | 1.0 | 5 | -3 | same-strand | Ribbon-helix-helix protein, copG family |