Result : A1VF29
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | 30S ribosomal protein S18 |
| NCBI Accession ID | CP000527.1 |
| Organism | Desulfovibrio vulgaris subsp. vulgaris (strain DP4) |
| Left | 2364326 |
| Right | 2364589 |
| Strand | - |
| Nucleotide Sequence | ATGGCCTTCAAGAAGAAGTTCGCTCCGCGCCGCAAGTTCTGCCGCTTCTGCGCCGACAAGGAACTGCCCATCGATTACAAGCGCGCCGACATCCTGCGCGACTTCATCACCGAACGTGGCAAGATCATCGCCCGTCGCATCACGGGCACCTGCGCCCATCACCAGCGCGTGCTGACCCGCGAAATCAAGCGTGCGCGTCAGATGGCCCTGCTGATCTACACCGCGACTCACTCCAGTGATGTCAAGAAAAAGAGCATTCTGTAG |
| Sequence | MAFKKKFAPRRKFCRFCADKELPIDYKRADILRDFITERGKIIARRITGTCAHHQRVLTREIKRARQMALLIYTATHSSDVKKKSIL |
| Source of smORF | Swiss-Prot |
| Function | Binds as a heterodimer with protein S6 to the central domain of the 16S rRNA, where it helps stabilize the platform of the 30S subunit. {ECO:0000255|HAMAP-Rule:MF_00270}. |
| Pubmed ID | 19737303 |
| Domain | CDD:412341 |
| Functional Category | Ribosomal_protein |
| Uniprot ID | A1VF29 |
| ORF Length (Amino Acid) | 87 |
++ More..
| Conservation Analysis |
No. of Species: 312
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1055303 | 1055566 | + | NC_017310.1 | Desulfovibrio vulgaris RCH1 |
| 2 | 140204 | 140467 | - | NZ_CP014229.1 | Desulfovibrio fairfieldensis |
| 3 | 1429498 | 1429761 | - | NC_007519.1 | Desulfovibrio alaskensis G20 |
| 4 | 1326437 | 1326697 | - | NZ_AP017378.1 | Desulfovibrio ferrophilus |
| 5 | 1235825 | 1236088 | + | NZ_LT907975.1 | Pseudodesulfovibrio profundus |
| 6 | 442979 | 443242 | + | NC_020127.1 | Lawsonia intracellularis N343 |
| 7 | 3923880 | 3924143 | + | NZ_CP039543.1 | Desulfovibrio marinus |
| 8 | 2439648 | 2439911 | - | NZ_CP046400.1 | Pseudodesulfovibrio cashew |
| 9 | 1401734 | 1401997 | - | NC_014844.1 | Pseudodesulfovibrio aespoeensis Aspo-2 |
| 10 | 970328 | 970591 | + | NC_016803.1 | Pseudodesulfovibrio mercurii |
| 11 | 2214847 | 2215107 | + | NC_012881.1 | Maridesulfovibrio salexigens DSM 2638 |
| 12 | 2269152 | 2269415 | - | NZ_CP014230.1 | Desulfomicrobium orale DSM 12838 |
| 13 | 2083629 | 2083892 | - | NC_013173.1 | Desulfomicrobium baculatum DSM 4028 |
| 14 | 3539866 | 3540126 | + | NC_016629.1 | Desulfocurvibacter africanus subsp. africanus str. Walvis Bay |
| 15 | 1285691 | 1285951 | + | NC_013223.1 | Desulfohalobium retbaense DSM 5692 |
| 16 | 655746 | 656003 | + | NZ_CP045504.1 | Desulfovibrio sulfodismutans DSM 3696 |
| 17 | 1900583 | 1900840 | + | NZ_CP045508.1 | Desulfolutivibrio sulfoxidireducens |
| 18 | 2841022 | 2841279 | - | NZ_CP026538.1 | Desulfovibrio carbinolicus |
| 19 | 3024754 | 3025011 | - | NC_012796.1 | Desulfovibrio magneticus RS-1 |
| 20 | 1241506 | 1241751 | + | NZ_CP010311.1 | Geoalkalibacter subterraneus |
| 21 | 8962 | 9183 | - | NC_009943.1 | Desulfococcus oleovorans Hxd3 |
| 22 | 2119704 | 2119955 | - | NC_012108.1 | Desulfobacterium autotrophicum HRM2 |
| 23 | 2493317 | 2493556 | + | NZ_CP054140.1 | Desulfobulbus oligotrophicus |
| 24 | 1950205 | 1950471 | + | NC_007759.1 | Syntrophus aciditrophicus SB |
| 25 | 2951508 | 2951729 | + | NC_006138.1 | Desulfotalea psychrophila LSv54 |
| 26 | 139293 | 139568 | + | NZ_CP042909.1 | Thermosulfurimonas marina |
| 27 | 1753416 | 1753691 | - | NC_015681.1 | Thermodesulfatator indicus DSM 15286 |
| 28 | 1362375 | 1362614 | + | NC_014216.1 | Desulfurivibrio alkaliphilus AHT 2 |
| 29 | 2099173 | 2099412 | + | NC_014972.1 | Desulfobulbus propionicus DSM 2032 |
| 30 | 2192383 | 2192652 | - | NZ_CP061800.1 | Desulfonema magnum |
| 31 | 1487840 | 1488082 | + | NC_018025.1 | Desulfomonile tiedjei DSM 6799 |
| 32 | 2654860 | 2655123 | + | NC_018645.1 | Desulfobacula toluolica Tol2 |
| 33 | 3123981 | 3124220 | - | NC_020304.1 | Desulfocapsa sulfexigens DSM 10523 |
| 34 | 2918040 | 2918312 | - | NZ_CP010802.1 | Desulfuromonas soudanensis |
| 35 | 871978 | 872220 | + | NZ_AP014945.1 | Caldimicrobium thiodismutans |
| 36 | 4305333 | 4305608 | - | NC_009483.1 | Geobacter uraniireducens Rf4 |
| 37 | 2532245 | 2532484 | - | NZ_CP021255.1 | Desulfobulbus oralis |
| 38 | 1731055 | 1731330 | + | NC_011979.1 | Geobacter daltonii FRC-32 |
| 39 | 41633 | 41857 | + | NZ_CP035130.1 | Gudongella oleilytica |
| 40 | 1686159 | 1686437 | + | NZ_AP023213.1 | Citrifermentans bremense |
| 41 | 3192050 | 3192328 | - | NC_011146.1 | Citrifermentans bemidjiense Bem |
| 42 | 89387 | 89614 | + | NZ_LT635480.1 | Ndongobacter massiliensis |
| 43 | 41729 | 41953 | + | NZ_CP068564.1 | Keratinibaculum paraultunense |
| 44 | 182228 | 182482 | - | NC_015682.1 | Thermodesulfobacterium geofontis OPF15 |
| 45 | 2860392 | 2860673 | + | NZ_CP061799.1 | Desulfonema limicola |
| 46 | 268331 | 268573 | + | NC_014926.1 | Thermovibrio ammonificans HB-1 |
| 47 | 3292272 | 3292502 | - | NZ_AP021853.1 | Sporolactobacillus terrae |
| 48 | 3588927 | 3589160 | - | NC_009253.1 | Desulfotomaculum reducens MI-1 |
| 49 | 1921565 | 1921852 | - | NZ_AP018437.1 | Pelolinea submarina |
| 50 | 2205517 | 2205789 | + | NZ_CP043046.1 | Pigmentiphaga aceris |
| 51 | 1943842 | 1944078 | - | NC_014365.1 | Desulfarculus baarsii DSM 2075 |
| 52 | 498628 | 498864 | + | NZ_CP070511.1 | Parageobacillus toebii |
| 53 | 1545891 | 1546118 | - | NZ_LT632322.1 | Murdochiella vaginalis |
| 54 | 2001509 | 2001760 | - | NZ_CP034413.2 | Dysosmobacter welbionis |
| 55 | 1213096 | 1213320 | - | NZ_LR134523.1 | Peptoniphilus ivorii |
| 56 | 31151 | 31411 | + | NZ_CP009302.1 | Berryella intestinalis |
| 57 | 207307 | 207534 | - | NC_015672.1 | Flexistipes sinusarabici DSM 4947 |
| 58 | 3524464 | 3524691 | + | NZ_CP022684.1 | Ketobacter alkanivorans |
| 59 | 4303538 | 4303765 | - | NC_014624.2 | Eubacterium callanderi |
| 60 | 2765211 | 2765438 | - | NZ_CP029487.1 | Eubacterium maltosivorans |
| 61 | 675312 | 675539 | - | NZ_CP019962.1 | Eubacterium limosum |
| 62 | 2117973 | 2118203 | - | NZ_CP017705.1 | Brevibacillus laterosporus DSM 25 |
| 63 | 3007833 | 3008066 | - | NC_018664.1 | Gottschalkia acidurici 9a |
| 64 | 4336253 | 4336528 | - | NZ_CP013019.1 | Clostridium pasteurianum |
| 65 | 2476691 | 2476912 | + | NC_014960.1 | Anaerolinea thermophila UNI-1 |
| 66 | 4031354 | 4031581 | - | NC_016894.1 | Acetobacterium woodii DSM 1030 |
| 67 | 26286 | 26552 | + | NZ_AP019367.1 | Parolsenella catena |
| 68 | 2554432 | 2554644 | - | NC_011899.1 | Halothermothrix orenii H 168 |
| 69 | 4795029 | 4795265 | - | NZ_CP036259.1 | Sporomusa termitida |
| 70 | 574427 | 574657 | + | NZ_CP026363.1 | Brevibacillus agri |
| 71 | 6643762 | 6643992 | - | NZ_LR134338.1 | Brevibacillus brevis |
| 72 | 3141972 | 3142205 | - | NC_008576.1 | Magnetococcus marinus MC-1 |
| 73 | 2134023 | 2134253 | + | NZ_LR134533.1 | Neisseria weaveri |
| 74 | 2803323 | 2803568 | - | NZ_CP040840.1 | Leptospira weilii |
| 75 | 150140 | 150406 | - | NZ_LR215036.1 | Mycoplasmopsis citelli |
| 76 | 512925 | 513152 | + | NZ_CP025120.1 | Kangiella profundi |
| 77 | 577421 | 577648 | + | NC_013166.1 | Kangiella koreensis DSM 16069 |
| 78 | 2025571 | 2025798 | - | NZ_CP010975.1 | Kangiella geojedonensis |
| 79 | 93973 | 94239 | - | NZ_LR215039.1 | Mycoplasmopsis columboralis |
| 80 | 2825407 | 2825634 | - | NC_014831.1 | Thermaerobacter marianensis DSM 12885 |
| 81 | 1466335 | 1466562 | - | NZ_AP021888.1 | Thiosulfativibrio zosterae |
| 82 | 1116866 | 1117138 | - | NZ_CP013119.1 | Alcaligenes faecalis |
| 83 | 4787 | 5017 | - | NC_013943.1 | Denitrovibrio acetiphilus DSM 12809 |
| 84 | 702556 | 702789 | + | NZ_CP060715.1 | Erysipelothrix inopinata |
| 85 | 3435564 | 3435833 | + | NZ_CP035807.1 | Thiospirochaeta perfilievii |
| 86 | 2036965 | 2037192 | - | NZ_CP012418.1 | Kangiella sediminilitoris |
| 87 | 3866599 | 3866844 | + | NZ_CP033614.1 | Leptospira kmetyi |
| 88 | 450472 | 450705 | + | NZ_CP034234.1 | Erysipelothrix piscisicarius |
| 89 | 201444 | 201677 | + | NZ_LR134439.1 | Erysipelothrix rhusiopathiae |
| 90 | 1604132 | 1604377 | + | NZ_CP015217.1 | Leptospira tipperaryensis |
| 91 | 562875 | 563120 | - | NZ_CP020414.2 | Leptospira interrogans serovar Copenhageni |
| 92 | 2509595 | 2509840 | - | NZ_CP026671.1 | Leptospira borgpetersenii serovar Ceylonica |
| 93 | 3287525 | 3287770 | - | NZ_CP030142.1 | Leptospira mayottensis |
| 94 | 1539909 | 1540124 | - | NC_012969.1 | Methylovorus glucosetrophus SIP3-4 |
| 95 | 10966 | 11205 | - | NZ_CP023665.1 | Bacillus paralicheniformis |
| 96 | 446524 | 446748 | - | NC_016751.1 | Marinitoga piezophila KA3 |
| 97 | 2950838 | 2951068 | + | NZ_CP068170.1 | Erysipelatoclostridium ramosum |
| 98 | 2724947 | 2725177 | - | NZ_AP024085.1 | Faecalibacillus intestinalis |
| 99 | 1946003 | 1946275 | + | NC_009767.1 | Roseiflexus castenholzii DSM 13941 |
| 100 | 1855073 | 1855291 | + | NZ_CP015249.1 | Dokdonella koreensis DS-123 |
| 101 | 4206937 | 4207176 | - | NC_006270.3 | Bacillus licheniformis DSM 13 = ATCC 14580 |
| 102 | 789088 | 789354 | - | NZ_CP012373.2 | Beggiatoa leptomitoformis |
| 103 | 1223990 | 1224217 | - | NZ_CP049916.1 | Acinetobacter lanii |
| 104 | 4532396 | 4532650 | + | NZ_LR026975.1 | Mycolicibacterium hassiacum DSM 44199 |
| 105 | 29111 | 29341 | + | NC_007503.1 | Carboxydothermus hydrogenoformans Z-2901 |
| 106 | 1546712 | 1546942 | - | NZ_AP019711.1 | Amedibacterium intestinale |
| 107 | 1558159 | 1558416 | - | NC_015318.1 | Hippea maritima DSM 10411 |
| 108 | 687896 | 688126 | + | NZ_CP011391.1 | Faecalibaculum rodentium |
| 109 | 5759165 | 5759398 | + | NZ_CP027860.1 | Ahniella affigens |
| 110 | 644052 | 644276 | - | NC_011653.1 | Thermosipho africanus TCF52B |
| 111 | 1777954 | 1778166 | + | NZ_CP012154.1 | Wenzhouxiangella marina |
| 112 | 1615919 | 1616179 | - | NC_015732.1 | Treponema caldarium DSM 7334 |
| 113 | 371888 | 372118 | - | NZ_CP035108.1 | Geovibrio thiophilus |
| 114 | 587851 | 588078 | + | NZ_CP072844.1 | Psychrosphaera aestuarii |
| 115 | 1572803 | 1573030 | + | NZ_CP045650.1 | Acinetobacter wanghuae |
| 116 | 781914 | 782174 | - | NZ_LR214986.1 | Mycoplasmopsis cynos |
| 117 | 562009 | 562233 | + | NC_021291.1 | Spiribacter salinus M19-40 |
| 118 | 3318563 | 3318790 | - | NZ_CP070518.1 | Acinetobacter calcoaceticus |
| 119 | 1372992 | 1373219 | - | NC_014259.1 | Acinetobacter oleivorans DR1 |
| 120 | 2017203 | 2017430 | + | NZ_CP071766.1 | Acinetobacter towneri |
| 121 | 1039698 | 1039925 | - | NZ_CP029397.2 | Acinetobacter defluvii |
| 122 | 2216510 | 2216737 | + | NZ_CP049801.1 | Acinetobacter shaoyimingii |
| 123 | 1909075 | 1909302 | + | NZ_CP016895.1 | Acinetobacter larvae |
| 124 | 2825240 | 2825467 | + | NZ_AP014630.1 | Acinetobacter guillouiae |
| 125 | 3075934 | 3076164 | - | NZ_AP019309.1 | Intestinibaculum porci |
| 126 | 2396932 | 2397159 | + | NC_005966.1 | Acinetobacter baylyi ADP1 |
| 127 | 1725347 | 1725571 | - | NZ_CP039268.1 | Thermochromatium tepidum ATCC 43061 |
| 128 | 3316894 | 3317130 | + | NC_016111.1 | Streptomyces cattleya NRRL 8057 = DSM 46488 |
| 129 | 84408 | 84635 | + | NZ_CP014137.1 | Brenneria goodwinii |
| 130 | 4591063 | 4591302 | - | NZ_LT603683.1 | Bacillus glycinifermentans |
| 131 | 1449658 | 1449921 | - | NC_014011.1 | Aminobacterium colombiense DSM 12261 |
| 132 | 2783059 | 2783286 | + | NZ_CP012808.1 | Acinetobacter equi |
| 133 | 1012724 | 1012960 | - | NZ_CP017703.1 | Aeribacillus pallidus |
| 134 | 4182879 | 4183106 | - | NZ_CP035129.1 | Kosakonia cowanii |
| 135 | 4000670 | 4000897 | - | NZ_CP006569.1 | Sodalis praecaptivus |
| 136 | 533326 | 533550 | + | NZ_AP017372.2 | Halorhodospira halochloris |
| 137 | 540485 | 540715 | + | NC_014758.1 | Calditerrivibrio nitroreducens DSM 19672 |
| 138 | 1904869 | 1905084 | - | NZ_AP022853.1 | Sulfurimicrobium lacus |
| 139 | 3277305 | 3277532 | - | NZ_LS483470.1 | Leminorella richardii |
| 140 | 137576 | 137800 | - | NZ_CP067016.1 | Anaerococcus obesiensis |
| 141 | 1951873 | 1952112 | + | NZ_CP014161.1 | Aerococcus urinae |
| 142 | 1283827 | 1284054 | - | NZ_CP044483.1 | Acinetobacter schindleri |
| 143 | 1497800 | 1498027 | - | NZ_CP035934.2 | Acinetobacter cumulans |
| 144 | 738193 | 738417 | - | NC_008789.1 | Halorhodospira halophila SL1 |
| 145 | 2125790 | 2126017 | + | NZ_CP032134.1 | Acinetobacter chinensis |
| 146 | 2189545 | 2189772 | + | NZ_CP030880.1 | Acinetobacter haemolyticus |
| 147 | 1668856 | 1669083 | + | NZ_CP041970.1 | Acinetobacter dispersus |
| 148 | 3418724 | 3418951 | - | NZ_CP040105.1 | Acinetobacter nosocomialis M2 |
| 149 | 1784041 | 1784268 | + | NC_016603.1 | Acinetobacter pittii PHEA-2 |
| 150 | 1420781 | 1421008 | - | NZ_CP053391.1 | Acinetobacter lactucae |
| 151 | 1388915 | 1389142 | - | NZ_CP015121.1 | Acinetobacter baumannii |
| 152 | 1449858 | 1450085 | - | NZ_CP065820.1 | Acinetobacter seifertii |
| 153 | 2634711 | 2634953 | - | NZ_CP018776.1 | Staphylococcus condimenti |
| 154 | 171900 | 172142 | - | NZ_CP033460.1 | Staphylococcus debuckii |
| 155 | 2077654 | 2077881 | + | NZ_CP024632.1 | Acinetobacter junii |
| 156 | 2029520 | 2029786 | - | NZ_CP027002.1 | [Ruminococcus] gnavus ATCC 29149 |
| 157 | 5012170 | 5012391 | - | NZ_CP023422.1 | Janthinobacterium svalbardensis |
| 158 | 2670104 | 2670325 | - | NZ_CP041185.1 | Janthinobacterium tructae |
| 159 | 5075094 | 5075315 | - | NZ_CP048832.1 | Janthinobacterium lividum |
| 160 | 633744 | 633968 | + | NC_008340.1 | Alkalilimnicola ehrlichii MLHE-1 |
| 161 | 828274 | 828504 | + | NZ_CP029556.1 | Lysobacter oculi |
| 162 | 678603 | 678827 | + | NZ_CP007389.1 | Thermosipho melanesiensis |
| 163 | 1279813 | 1280034 | - | NC_012968.1 | Methylotenera mobilis JLW8 |
| 164 | 1415855 | 1416079 | - | NZ_CP066014.1 | Anaerococcus vaginalis |
| 165 | 6008520 | 6008756 | - | NC_013235.1 | Nakamurella multipartita DSM 44233 |
| 166 | 3319445 | 3319672 | - | NZ_LN907827.1 | Erwinia gerundensis |
| 167 | 3682982 | 3683209 | - | NC_017910.1 | Shimwellia blattae DSM 4481 = NBRC 105725 |
| 168 | 3971977 | 3972204 | + | NZ_CP027107.1 | Cronobacter sakazakii |
| 169 | 399518 | 399745 | + | NZ_CP013940.1 | Cronobacter malonaticus LMG 23826 |
| 170 | 3711970 | 3712197 | - | NZ_CP012257.1 | Cronobacter universalis NCTC 9529 |
| 171 | 1203293 | 1203520 | - | NZ_CP042941.1 | Atlantibacter hermannii |
| 172 | 3788332 | 3788559 | - | NZ_CP012264.1 | Cronobacter condimenti 1330 |
| 173 | 254061 | 254288 | + | NZ_CP012268.1 | Cronobacter muytjensii ATCC 51329 |
| 174 | 3891744 | 3891971 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 175 | 3880277 | 3880504 | - | NZ_CP012266.1 | Cronobacter dublinensis subsp. dublinensis LMG 23823 |
| 176 | 451939 | 452166 | + | NZ_LR134340.1 | Escherichia marmotae |
| 177 | 2410193 | 2410420 | + | NZ_CP053416.1 | Salmonella bongori |
| 178 | 3346498 | 3346725 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 179 | 4530116 | 4530343 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 180 | 4425839 | 4426066 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 181 | 4460977 | 4461204 | + | NZ_AP014857.1 | Escherichia albertii |
| 182 | 4092901 | 4093128 | - | NZ_LR134201.1 | Cedecea lapagei |
| 183 | 4631250 | 4631477 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 184 | 3636462 | 3636689 | + | NZ_CP016337.1 | Kosakonia sacchari |
| 185 | 489259 | 489486 | + | NZ_CP063425.1 | Kosakonia pseudosacchari |
| 186 | 1863104 | 1863331 | - | NZ_CP044098.1 | Citrobacter portucalensis |
| 187 | 3217911 | 3218138 | + | NZ_CP033744.1 | Citrobacter freundii |
| 188 | 2650076 | 2650303 | - | NZ_CP045300.1 | Kosakonia arachidis |
| 189 | 580443 | 580670 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
| 190 | 4712660 | 4712887 | - | NZ_LR134475.1 | Klebsiella aerogenes |
| 191 | 4377525 | 4377752 | - | NZ_CP023525.1 | Cedecea neteri |
| 192 | 4744449 | 4744676 | - | NZ_CP065838.1 | Klebsiella quasipneumoniae |
| 193 | 4796984 | 4797211 | - | NZ_CP041247.1 | Raoultella electrica |
| 194 | 477541 | 477768 | + | NC_016845.1 | Klebsiella pneumoniae subsp. pneumoniae HS11286 |
| 195 | 3437074 | 3437301 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 196 | 1461928 | 1462155 | + | NZ_CP020388.1 | Pluralibacter gergoviae |
| 197 | 4869876 | 4870103 | - | NZ_CP014007.2 | Kosakonia oryzae |
| 198 | 1085062 | 1085289 | + | NZ_CP045205.1 | Citrobacter telavivensis |
| 199 | 2222459 | 2222686 | + | NZ_CP026047.1 | Raoultella planticola |
| 200 | 5279692 | 5279919 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 201 | 5025581 | 5025808 | - | NZ_CP054254.1 | Klebsiella variicola |
| 202 | 5089165 | 5089392 | - | NZ_CP046672.1 | Raoultella ornithinolytica |
| 203 | 210608 | 210835 | + | NZ_CP015113.1 | Kosakonia radicincitans |
| 204 | 5506580 | 5506807 | - | NZ_CP060111.1 | Klebsiella michiganensis |
| 205 | 883225 | 883449 | + | NC_014225.1 | Waddlia chondrophila WSU 86-1044 |
| 206 | 2016978 | 2017208 | + | NC_013939.1 | Deferribacter desulfuricans SSM1 |
| 207 | 2345731 | 2345973 | - | NZ_CP054482.1 | Macrococcus bohemicus |
| 208 | 1662056 | 1662295 | + | NZ_CP017786.1 | Bacillus xiamenensis |
| 209 | 61554 | 61778 | + | NZ_LR134524.1 | Peptoniphilus harei |
| 210 | 992964 | 993188 | + | NC_011901.1 | Thioalkalivibrio sulfidiphilus HL-EbGr7 |
| 211 | 1717735 | 1717962 | + | NZ_CP031222.1 | Aquirhabdus parva |
| 212 | 2373150 | 2373377 | - | NZ_CP007142.1 | Gynuella sunshinyii YC6258 |
| 213 | 1977103 | 1977330 | - | NZ_LR134343.1 | Moraxella cuniculi |
| 214 | 2497706 | 2497936 | - | NZ_CP012900.1 | Stenotrophomonas acidaminiphila |
| 215 | 2499276 | 2499506 | - | NC_008260.1 | Alcanivorax borkumensis SK2 |
| 216 | 5598738 | 5598974 | - | NC_013510.1 | Thermomonospora curvata DSM 43183 |
| 217 | 2297956 | 2298180 | - | NC_013851.1 | Allochromatium vinosum DSM 180 |
| 218 | 653147 | 653368 | + | NZ_AP014568.1 | Serpentinomonas raichei |
| 219 | 833302 | 833529 | + | NZ_AP018724.1 | Sulfurivermis fontis |
| 220 | 2943718 | 2943948 | - | NZ_CP037883.1 | Stenotrophomonas indicatrix |
| 221 | 2829480 | 2829710 | - | NZ_LS483377.1 | Stenotrophomonas maltophilia |
| 222 | 1999102 | 1999332 | - | NZ_CP046570.1 | Xanthomonas albilineans |
| 223 | 1924177 | 1924407 | + | NZ_LT853882.1 | Xanthomonas fragariae |
| 224 | 1812258 | 1812473 | - | NC_022357.1 | Sulfuricella denitrificans skB26 |
| 225 | 1269736 | 1269963 | - | NC_014147.1 | Moraxella catarrhalis BBH18 |
| 226 | 1773246 | 1773473 | - | NZ_CP065728.1 | Moraxella nonliquefaciens |
| 227 | 388249 | 388491 | + | NZ_LT906460.1 | Staphylococcus simiae |
| 228 | 1906840 | 1907067 | - | NZ_CP030241.1 | Moraxella bovis |
| 229 | 409910 | 410152 | + | NZ_AP018558.1 | Hydrogenophilus thermoluteolus |
| 230 | 224770 | 225030 | - | NZ_LR214972.1 | Mycoplasmopsis bovirhinis |
| 231 | 734324 | 734551 | + | NZ_CP011381.2 | Moraxella bovoculi |
| 232 | 801260 | 801487 | + | NZ_CP011158.1 | Moraxella ovis |
| 233 | 3727540 | 3727779 | - | NZ_CP011150.1 | Bacillus altitudinis |
| 234 | 4895259 | 4895495 | - | NZ_CP042593.1 | Bacillus dafuensis |
| 235 | 1813734 | 1813964 | + | NZ_CP023406.1 | Luteimonas chenhongjianii |
| 236 | 842054 | 842284 | + | NC_018691.1 | Alcanivorax dieselolei B5 |
| 237 | 3533495 | 3533719 | - | NZ_LR699011.1 | Roseburia hominis |
| 238 | 1904342 | 1904572 | + | NZ_CP048044.1 | Xanthomonas citri |
| 239 | 3289883 | 3290119 | - | NZ_CP016543.2 | Planococcus donghaensis |
| 240 | 3409231 | 3409467 | - | NZ_CP016537.2 | Planococcus halocryophilus |
| 241 | 1778643 | 1778879 | + | NZ_CP013661.2 | Planococcus kocurii |
| 242 | 3480364 | 3480600 | - | NZ_CP019401.1 | Planococcus faecalis |
| 243 | 3749924 | 3750160 | - | NZ_CP016534.2 | Planococcus antarcticus DSM 14505 |
| 244 | 1500181 | 1500405 | + | NZ_CP035704.1 | Pseudolysobacter antarcticus |
| 245 | 707857 | 708099 | + | NZ_AP017470.1 | Thermotomaculum hydrothermale |
| 246 | 18391 | 18630 | + | NZ_CP011937.1 | Bacillus velezensis |
| 247 | 3234204 | 3234440 | - | NZ_CP016540.2 | Planococcus versutus |
| 248 | 674780 | 675007 | + | NZ_CP014234.1 | Moraxella osloensis |
| 249 | 347775 | 348005 | + | NZ_CP045871.1 | Litoricola lipolytica |
| 250 | 1882127 | 1882360 | + | NC_016630.1 | Filifactor alocis ATCC 35896 |
| 251 | 54597 | 54839 | + | NZ_CP045927.1 | Staphylococcus agnetis |
| 252 | 2380921 | 2381151 | - | NZ_CP053627.1 | Xylella taiwanensis |
| 253 | 1172731 | 1172952 | - | NZ_LT671418.1 | Herminiimonas arsenitoxidans |
| 254 | 1707146 | 1707373 | + | NZ_CP051461.1 | Polaromonas vacuolata |
| 255 | 3289819 | 3290049 | + | NZ_CP060711.1 | Thermomonas brevis |
| 256 | 1712968 | 1713207 | - | NZ_CP019573.1 | Abyssicoccus albus |
| 257 | 2570949 | 2571179 | + | NZ_CP060731.1 | Pseudoxanthomonas mexicana |
| 258 | 1319776 | 1320000 | + | NZ_AP014879.1 | Sulfuricaulis limicola |
| 259 | 861589 | 861855 | - | NC_013512.1 | Sulfurospirillum deleyianum DSM 6946 |
| 260 | 895015 | 895281 | - | NC_018002.1 | Sulfurospirillum barnesii SES-3 |
| 261 | 1152466 | 1152732 | - | NZ_CP017111.1 | Sulfurospirillum halorespirans DSM 13726 |
| 262 | 1075244 | 1075510 | - | NZ_CP007201.1 | Sulfurospirillum multivorans DSM 12446 |
| 263 | 777257 | 777484 | - | NZ_CP034588.1 | Silicimonas algicola |
| 264 | 2420869 | 2421096 | + | NC_003911.12 | Ruegeria pomeroyi DSS-3 |
| 265 | 2904318 | 2904548 | + | NZ_CP042218.1 | Luteimonas granuli |
| 266 | 3011405 | 3011632 | - | NZ_CP014327.1 | Halocynthiibacter arcticus |
| 267 | 2699284 | 2699520 | - | NC_014614.1 | Acetoanaerobium sticklandii |
| 268 | 680668 | 680895 | + | NZ_CP051181.1 | Thalassobius gelatinovorus |
| 269 | 1261282 | 1261509 | - | NZ_CP032125.1 | Profundibacter amoris |
| 270 | 3424737 | 3424964 | + | NZ_CP024422.1 | Paracoccus yeei |
| 271 | 2333415 | 2333642 | + | NZ_LN832559.1 | Paracoccus aminovorans |
| 272 | 2074468 | 2074695 | + | NZ_CP012023.1 | Celeribacter marinus |
| 273 | 1197590 | 1197817 | + | NZ_CP049037.1 | Pseudohalocynthiibacter aestuariivivens |
| 274 | 2458496 | 2458723 | + | NZ_CP024899.1 | Rhodobaca barguzinensis |
| 275 | 1941788 | 1942015 | + | NZ_CP003984.1 | Planktomarina temperata RCA23 |
| 276 | 1904758 | 1904985 | + | NZ_CP016364.1 | Phaeobacter porticola |
| 277 | 1890229 | 1890456 | + | NZ_CP010650.1 | Phaeobacter inhibens |
| 278 | 1540211 | 1540438 | - | NZ_CP021047.1 | Phaeobacter gallaeciensis |
| 279 | 2215322 | 2215549 | + | NZ_CP010855.1 | Marinovum algicola DG 898 |
| 280 | 2313936 | 2314163 | + | NC_009952.1 | Dinoroseobacter shibae DFL 12 = DSM 16493 |
| 281 | 1623298 | 1623525 | + | NZ_CP041159.1 | Leisingera aquaemixtae |
| 282 | 2149045 | 2149272 | + | NZ_CP048788.1 | Roseobacter ponti |
| 283 | 937141 | 937368 | + | NZ_CP027407.1 | Roseobacter denitrificans |
| 284 | 1825592 | 1825819 | + | NC_023135.1 | Leisingera methylohalidivorans DSM 14336 |
| 285 | 1429747 | 1429974 | - | NC_015730.1 | Roseobacter litoralis Och 149 |
| 286 | 1783891 | 1784118 | + | NZ_CP021404.1 | Pacificitalea manganoxidans |
| 287 | 2622066 | 2622293 | + | NZ_CP012661.1 | Defluviimonas alba |
| 288 | 2141831 | 2142067 | + | NZ_CP047156.1 | Epidermidibacterium keratini |
| 289 | 1001951 | 1002178 | + | NC_007963.1 | Chromohalobacter salexigens DSM 3043 |
| 290 | 875366 | 875593 | + | NZ_CP061498.1 | Roseicitreum antarcticum |
| 291 | 1610662 | 1610889 | - | NZ_CP054599.1 | Sulfitobacter pseudonitzschiae |
| 292 | 1344434 | 1344661 | + | NZ_CP022196.1 | Celeribacter ethanolicus |
| 293 | 972071 | 972298 | - | NZ_CP045072.1 | Paracoccus kondratievae |
| 294 | 770310 | 770537 | + | NZ_CP021435.1 | Halomonas beimenensis |
| 295 | 680061 | 680288 | - | NC_022041.1 | Paracoccus aminophilus JCM 7686 |
| 296 | 1698156 | 1698383 | + | NZ_CP015230.1 | Epibacterium mobile F1926 |
| 297 | 4014732 | 4014959 | - | NZ_CP034328.1 | Tabrizicola piscis |
| 298 | 2565804 | 2566028 | - | NZ_CP019437.1 | Thioclava nitratireducens |
| 299 | 2478418 | 2478642 | - | NZ_CP053562.1 | Thioclava electrotropha |
| 300 | 3522400 | 3522630 | - | NC_020888.1 | Thalassolituus oleivorans MIL-1 |
| 301 | 2414748 | 2414978 | - | NZ_CP017715.1 | Marinobacter salinus |
| 302 | 1738739 | 1738969 | + | NC_007645.1 | Hahella chejuensis KCTC 2396 |
| 303 | 318975 | 319202 | + | NZ_CP045350.1 | Vibrio aquimaris |
| 304 | 105485 | 105712 | + | NZ_CP016414.1 | Vibrio scophthalmi |
| 305 | 2949027 | 2949254 | - | NZ_CP009354.1 | Vibrio tubiashii ATCC 19109 |
| 306 | 2193495 | 2193722 | + | NZ_CP019959.1 | Vibrio owensii |
| 307 | 2614831 | 2615058 | + | NZ_CP025792.1 | Vibrio jasicida 090810c |
| 308 | 650045 | 650275 | + | NC_017506.1 | Marinobacter adhaerens HP15 |
| 309 | 3488282 | 3488512 | - | NZ_CP020931.1 | Marinobacter salarius |
| 310 | 3533464 | 3533691 | - | NC_016041.1 | Glaciecola nitratireducens FR1064 |
| 311 | 1097857 | 1098087 | + | NZ_CP043042.1 | Marinobacter fonticola |
| 312 | 968614 | 968841 | + | NZ_CP014544.1 | Zhongshania aliphaticivorans |
| 313 | 1288756 | 1288986 | + | NC_020541.1 | Rhodanobacter denitrificans |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_017310.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01250.19 | 1.0 | 311 | 325.0 | same-strand | Ribosomal protein S6 |
| 2 | PF03948.16 | 0.85 | 265 | 35.0 | same-strand | Ribosomal protein L9, C-terminal domain |
| 3 | PF01281.21 | 0.86 | 267 | 35.0 | same-strand | Ribosomal protein L9, N-terminal domain |
++ More..