Result : O06753
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Uncharacterized protein YitR |
| NCBI Accession ID | Y09476.1 |
| Organism | Bacillus subtilis (strain 168) |
| Left | 42807 |
| Right | 43100 |
| Strand | + |
| Nucleotide Sequence | ATGGAAATCAGCATCAATTATCTATTAATTGTCATCGCGCTTTTATTCTTTGTGGTTGCCTATTTTGTCGGAATCAAAAAACAAACCTGGATGTTGGCTGGGTTTAACGAGGCGCGTATACGGGATAAAGATCGGCTGGCCAGAATAGCAGGCTACTTTTTCTTGAATTCCGGTTTGTTCATTTTGCTGAATAGTTTTATCTCATTTCAAGGTCAGGAGCAGCTCATACCTCCGCTTATACTGGCATATGGAGCAGGGGTTATTATTTATGTCAATAAAAAATTAGTAGAGTAG |
| Sequence | MEISINYLLIVIALLFFVVAYFVGIKKQTWMLAGFNEARIRDKDRLARIAGYFFLNSGLFILLNSFISFQGQEQLIPPLILAYGAGVIIYVNKKLVE |
| Source of smORF | Swiss-Prot |
| Function | The ORF matches to the profile of pfam12650. Profile Description: Domain of unknown function (DUF3784). This family of proteins is functionally uncharacterized. This family of proteins is found in bacteria and archaea. Proteins in this family are typically between 96 and 110 amino acids in length. |
| Pubmed ID | 9353932 9384377 |
| Domain | CDD:403751 |
| Functional Category | Others |
| Uniprot ID | O06753 |
| ORF Length (Amino Acid) | 97 |
++ More..
| Conservation Analysis |
No. of Species: 8
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1185608 | 1185901 | + | NC_000964.3 | Bacillus subtilis subsp. subtilis str. 168 |
| 2 | 803953 | 804246 | - | NZ_CP029364.1 | Bacillus halotolerans |
| 3 | 1163748 | 1164041 | + | NZ_CP013984.1 | Bacillus inaquosorum |
| 4 | 1189352 | 1189645 | + | NZ_CP051464.1 | Bacillus mojavensis |
| 5 | 1156503 | 1156793 | + | NZ_CP034943.1 | Bacillus subtilis subsp. spizizenii ATCC 6633 = JCM 2499 |
| 6 | 1350869 | 1351159 | + | NZ_CP033052.1 | Bacillus vallismortis |
| 7 | 1113735 | 1113986 | + | NZ_CP048852.1 | Bacillus tequilensis |
| 8 | 1230536 | 1230829 | + | NZ_LT603683.1 | Bacillus glycinifermentans |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000964.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02645.18 | 0.88 | 7 | 1799 | opposite-strand | Uncharacterised protein, DegV family COG1307 |
| 2 | PF02588.17 | 0.88 | 7 | 2788 | same-strand | Uncharacterised 5xTM membrane BCR, YitT family COG1284 |
| 3 | PF10035.11 | 0.88 | 7 | 2788 | same-strand | Uncharacterized protein conserved in bacteria (DUF2179) |
| 4 | PF12690.9 | 0.88 | 7 | 3649 | same-strand | Intracellular proteinase inhibitor |
++ More..