Result : G8QM64
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Methionine-rich peptide X |
| NCBI Accession ID | CP003153.1 |
| Organism | Azospira oryzae (strain ATCC BAA-33 / DSM 13638 / PS) (Dechlorosoma suillum) |
| Left | 163438 |
| Right | 163677 |
| Strand | + |
| Nucleotide Sequence | ATGAAAAAGCTCGCCGCAGTAATGCTCACCTCCTGCCTTATGGTCGCCGTCGGCGCATCCTTCGCCGACGAAATGAAGAAGGATGACATGAAGAAAGACGTGATGATGAAGAAGGATGACATGGCCAAAGATGAAATGAAGAAGGACAGTATGGCCAAGGATGGCATGAAAAAGGATGCCATGAAGAAAGACGCGATGATGAAGAAGGATGGCATGACCAAGGATGAAATGAAGAAGTAA |
| Sequence | MKKLAAVMLTSCLMVAVGASFADEMKKDDMKKDVMMKKDDMAKDEMKKDSMAKDGMKKDAMKKDAMMKKDGMTKDEMKK |
| Source of smORF | Swiss-Prot |
| Function | Serves as an oxidative stress sink, specifically for chlorite and hypochlorite. {ECO:0000269|Pubmed:25968643}. |
| Pubmed ID | 22535943 25968643 |
| Domain | CDD:131998 |
| Functional Category | Others |
| Uniprot ID | G8QM64 |
| ORF Length (Amino Acid) | 79 |
++ More..
| Conservation Analysis |
No. of Species: 27
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4372560 | 4372826 | - | NZ_CP051487.1 | Pseudomonas umsongensis |
| 2 | 1592581 | 1592856 | + | NC_015567.1 | Serratia plymuthica AS9 |
| 3 | 1621211 | 1621486 | + | NZ_LT906479.1 | Serratia ficaria |
| 4 | 1582857 | 1583132 | + | NZ_CP038662.1 | Serratia nematodiphila |
| 5 | 604622 | 604879 | - | NZ_CP023525.1 | Cedecea neteri |
| 6 | 2974007 | 2974288 | + | NZ_CP062253.1 | Pseudomonas gozinkensis |
| 7 | 606850 | 607122 | - | NZ_LR134201.1 | Cedecea lapagei |
| 8 | 2609125 | 2609373 | + | NZ_LT671418.1 | Herminiimonas arsenitoxidans |
| 9 | 2351068 | 2351334 | + | NZ_CP014870.1 | Pseudomonas silesiensis |
| 10 | 354931 | 355197 | + | NZ_CP067059.1 | Rahnella aceris |
| 11 | 2006591 | 2006857 | + | NZ_CP045300.1 | Kosakonia arachidis |
| 12 | 2967877 | 2968128 | + | NZ_AP021881.1 | Sulfuriferula nivalis |
| 13 | 791077 | 791352 | - | NZ_AP023184.1 | Buttiauxella agrestis |
| 14 | 837450 | 837725 | - | NZ_CP062803.1 | Cupriavidus basilensis |
| 15 | 3760146 | 3760391 | - | NZ_CP023422.1 | Janthinobacterium svalbardensis |
| 16 | 3874978 | 3875196 | - | NC_017082.1 | Bradyrhizobium cosmicum |
| 17 | 2276558 | 2276767 | - | NC_014217.1 | Starkeya novella DSM 506 |
| 18 | 7053170 | 7053388 | - | NZ_CP044543.1 | Bradyrhizobium betae |
| 19 | 2699645 | 2699854 | + | NZ_CP058907.1 | Rhodopseudomonas palustris |
| 20 | 811035 | 811289 | - | NZ_CP012541.1 | Campylobacter concisus |
| 21 | 812477 | 812674 | - | NZ_CP054028.1 | Rhizobium hidalgonense |
| 22 | 812477 | 812674 | - | NZ_CP054028.1 | Rhizobium hidalgonense |
| 23 | 1619997 | 1620206 | - | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 24 | 4828923 | 4829177 | + | NZ_CP032617.1 | Bradyrhizobium diazoefficiens |
| 25 | 4239888 | 4240112 | - | NZ_LS398110.1 | Bradyrhizobium vignae |
| 26 | 3190920 | 3191144 | + | NZ_CP029426.1 | Bradyrhizobium amphicarpaeae |
| 27 | 1295291 | 1295548 | + | NZ_CP013450.1 | Burkholderia cenocepacia |
| 28 | 3260620 | 3260892 | - | NC_007651.1 | Burkholderia thailandensis E264 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP051487.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00174.21 | 0.74 | 20 | 61.5 | same-strand | Oxidoreductase molybdopterin binding domain |
| 2 | PF01292.22 | 0.74 | 20 | 847.5 | same-strand | Prokaryotic cytochrome b561 |
| 3 | PF14358.8 | 0.67 | 18 | 847.5 | same-strand | Domain of unknown function (DUF4405) |
++ More..