Result : G3MTW7
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Putative membrane protein PmrR |
| NCBI Accession ID | U00096.3 |
| Organism | Escherichia coli (strain K12) |
| Left | 4332116 |
| Right | 4332205 |
| Strand | + |
| Nucleotide Sequence | ATGAAAAACCGTGTTTATGAAAGTTTAACTACCGTGTTCAGCGTGCTGGTGGTCAGCAGCTTTCTTTATATCTGGTTTGCCACGTACTGA |
| Sequence | MKNRVYESLTTVFSVLVVSSFLYIWFATY |
| Source of smORF | Swiss-Prot |
| Function | May bind to BasS and modulate its sensor kinase activity. {ECO:0000305}. |
| Pubmed ID | 8421314 7610040 9278503 16738553 |
| Domain | CDD:380220 |
| Functional Category | Others |
| Uniprot ID | G3MTW7 |
| ORF Length (Amino Acid) | 29 |
++ More..
| Conservation Analysis |
No. of Species: 15
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4332116 | 4332205 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 358102 | 358191 | + | NZ_LR134340.1 | Escherichia marmotae |
| 3 | 5186692 | 5186781 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 4 | 4276351 | 4276440 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 5 | 4152006 | 4152095 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 6 | 3264459 | 3264548 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 7 | 4344473 | 4344562 | + | NZ_AP014857.1 | Escherichia albertii |
| 8 | 688848 | 688937 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
| 9 | 980505 | 980594 | + | NZ_CP045205.1 | Citrobacter telavivensis |
| 10 | 3675982 | 3676071 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 11 | 1961104 | 1961193 | - | NZ_CP044098.1 | Citrobacter portucalensis |
| 12 | 2996924 | 2997013 | - | NZ_CP038469.1 | Citrobacter tructae |
| 13 | 3126713 | 3126802 | + | NZ_CP033744.1 | Citrobacter freundii |
| 14 | 3494282 | 3494371 | - | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 15 | 4532558 | 4532647 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 16 | 2277101 | 2277190 | + | NZ_CP053416.1 | Salmonella bongori |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LT556085.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03831.16 | 0.93 | 14 | 5400 | opposite-strand | PhnA domain |
| 2 | PF08274.14 | 0.93 | 14 | 5400 | opposite-strand | PhnA Zinc-Ribbon |
| 3 | PF00350.25 | 0.67 | 10 | 4169 | same-strand | Dynamin family |
| 4 | PF01926.25 | 0.67 | 10 | 4169 | same-strand | 50S ribosome-binding GTPase |
| 5 | PF13990.8 | 0.73 | 11 | 2591.5 | same-strand | YjcZ-like protein |
| 6 | PF00083.26 | 1.0 | 15 | 112.0 | same-strand | Sugar (and other) transporter |
| 7 | PF08946.12 | 1.0 | 15 | 112.0 | same-strand | Osmosensory transporter coiled coil |
| 8 | PF02518.28 | 1.0 | 15 | -6.0 | opposite-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
| 9 | PF00512.27 | 1.0 | 15 | -6.0 | opposite-strand | His Kinase A (phospho-acceptor) domain |
| 10 | PF00672.27 | 0.8 | 12 | -6 | opposite-strand | HAMP domain |
| 11 | PF00072.26 | 0.93 | 14 | 1077 | opposite-strand | Response regulator receiver domain |
| 12 | PF00486.30 | 1.0 | 15 | 1077.0 | opposite-strand | Transcriptional regulatory protein, C terminal |
| 13 | PF00884.25 | 1.0 | 15 | 1746.5 | opposite-strand | Sulfatase |
| 14 | PF08019.14 | 1.0 | 15 | 1746.5 | opposite-strand | Phosphoethanolamine transferase EptA/EptB |
| 15 | PF13520.8 | 0.8 | 12 | 3494 | opposite-strand | Amino acid permease |
| 16 | PF00324.23 | 0.8 | 12 | 3494 | opposite-strand | Amino acid permease |
| 17 | PF00165.25 | 0.8 | 12 | 4963 | opposite-strand | Bacterial regulatory helix-turn-helix proteins, AraC family |
| 18 | PF12833.9 | 0.8 | 12 | 4963 | opposite-strand | Helix-turn-helix domain |
| 19 | PF11781.10 | 0.67 | 10 | 7051.5 | opposite-strand | Zinc-finger of RNA-polymerase I-specific TFIIB, Rrn7 |
++ More..