Result : F7XXN6
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Cell division protein FtsL |
| NCBI Accession ID | CP002243.1 |
| Organism | Moranella endobia (strain PCIT) |
| Left | 254397 |
| Right | 254666 |
| Strand | + |
| Nucleotide Sequence | ATGATCGATAGAAAACATTATCACTTAGTTGGAAGCATAGGTAAAGATATATTAAATAATGGCAAACTGCCCGCGCTATTACTGATTGCGGTTCTCGCCTCATCGAGCTTGGTAGTTATAACCACCTACCAAACCAGGCGGCTAACAGTTGAACGTGAGCAACTGCTTCTAGAACAGAATATATTAGATATCGAGTGGCGTAACCTGATCCTAGAAGATAATGTTATTAGCGATCAAAGTCGCTTTGAGTTTGTCGCCACTGAGCAGTGA |
| Sequence | MIDRKHYHLVGSIGKDILNNGKLPALLLIAVLASSSLVVITTYQTRRLTVEREQLLLEQNILDIEWRNLILEDNVISDQSRFEFVATEQ |
| Source of smORF | Swiss-Prot |
| Function | Essential cell division protein. May link together the upstream cell division proteins, which are predominantly cytoplasmic, with the downstream cell division proteins, which are predominantly periplasmic. {ECO:0000255|HAMAP-Rule:MF_00910}. |
| Pubmed ID | 21835622 |
| Domain | CDD:416267 |
| Functional Category | Others |
| Uniprot ID | F7XXN6 |
| ORF Length (Amino Acid) | 89 |
++ More..
| Conservation Analysis |
No. of Species: 126
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4964353 | 4964670 | + | NZ_CP015749.1 | Pectobacterium parmentieri |
| 2 | 4144116 | 4144436 | - | NZ_CP009125.1 | Pectobacterium atrosepticum |
| 3 | 854097 | 854417 | + | NZ_CP065044.1 | Pectobacterium aroidearum |
| 4 | 991894 | 992214 | - | NZ_CP023706.1 | Edwardsiella tarda |
| 5 | 3018292 | 3018612 | - | NZ_CP016043.1 | Edwardsiella hoshinae |
| 6 | 706370 | 706690 | + | NZ_CP051652.1 | Pectobacterium carotovorum |
| 7 | 3978045 | 3978362 | - | NZ_CP038498.1 | Pectobacterium punjabense |
| 8 | 2379284 | 2379604 | + | NZ_CP047495.1 | Pectobacterium brasiliense |
| 9 | 891340 | 891657 | - | NZ_CP015750.1 | Pectobacterium wasabiae CFBP 3304 |
| 10 | 5215405 | 5215725 | + | NZ_CP014137.1 | Brenneria goodwinii |
| 11 | 3132704 | 3133024 | - | NZ_CP034035.1 | Brenneria rubrifaciens |
| 12 | 841052 | 841372 | + | NZ_LT906479.1 | Serratia ficaria |
| 13 | 3752094 | 3752414 | - | NZ_CP050150.1 | Hafnia alvei |
| 14 | 4173023 | 4173343 | - | NZ_CP034938.1 | Pectobacterium odoriferum |
| 15 | 2975902 | 2976222 | - | NZ_CP017482.1 | Pectobacterium polaris |
| 16 | 2433503 | 2433823 | + | NZ_CP006664.1 | Edwardsiella anguillarum ET080813 |
| 17 | 2817702 | 2818022 | - | NZ_CP067057.1 | Rahnella aceris |
| 18 | 3437702 | 3438022 | - | NZ_CP015581.1 | Tatumella citrea |
| 19 | 1879600 | 1879920 | - | NZ_CP014136.1 | Gibbsiella quercinecans |
| 20 | 858913 | 859233 | + | NC_014306.1 | Erwinia billingiae Eb661 |
| 21 | 725900 | 726220 | + | NC_012779.2 | Edwardsiella ictaluri 93-146 |
| 22 | 3889047 | 3889367 | - | NZ_CP011118.1 | Yersinia enterocolitica |
| 23 | 2704825 | 2705145 | + | NZ_CP011254.1 | Serratia fonticola |
| 24 | 5182938 | 5183258 | - | NZ_CP007044.2 | Chania multitudinisentens RB-25 |
| 25 | 827822 | 828142 | + | NZ_CP043727.1 | Yersinia canariae |
| 26 | 3682040 | 3682360 | + | NZ_CP009787.1 | Yersinia rohdei |
| 27 | 2039889 | 2040209 | + | NZ_CP054043.1 | Yersinia mollaretii ATCC 43969 |
| 28 | 4305966 | 4306286 | - | NZ_CP071320.1 | Serratia ureilytica |
| 29 | 714723 | 715043 | + | NZ_CP048784.1 | Serratia liquefaciens |
| 30 | 3139590 | 3139910 | - | NZ_CP023567.1 | Erwinia pyrifoliae |
| 31 | 750927 | 751247 | + | NZ_LR134494.1 | Serratia quinivorans |
| 32 | 2285061 | 2285381 | + | NZ_CP065640.1 | Serratia rubidaea |
| 33 | 3765237 | 3765554 | - | NZ_LR134373.1 | Yersinia pseudotuberculosis |
| 34 | 82940 | 83260 | + | NZ_CP016948.1 | Serratia surfactantfaciens |
| 35 | 759579 | 759899 | + | NZ_CP038662.1 | Serratia nematodiphila |
| 36 | 755338 | 755658 | - | NZ_CP019706.1 | Pantoea alhagi |
| 37 | 818007 | 818327 | + | NZ_CP032487.1 | Yersinia hibernica |
| 38 | 688565 | 688885 | + | NZ_CP042220.2 | Dickeya poaceiphila |
| 39 | 2991924 | 2992244 | - | NC_013961.1 | Erwinia amylovora CFBP1430 |
| 40 | 773982 | 774302 | + | NC_015567.1 | Serratia plymuthica AS9 |
| 41 | 836935 | 837255 | + | NC_010694.1 | Erwinia tasmaniensis Et1/99 |
| 42 | 723078 | 723311 | + | NC_012880.1 | Musicola paradisiaca Ech703 |
| 43 | 3873512 | 3873832 | - | NZ_CP046293.1 | Yersinia intermedia |
| 44 | 2242587 | 2242841 | - | NC_010554.1 | Proteus mirabilis HI4320 |
| 45 | 492031 | 492348 | - | NZ_CP026364.1 | Proteus hauseri |
| 46 | 1257555 | 1257872 | + | NC_012962.1 | Photorhabdus asymbiotica |
| 47 | 2046943 | 2047212 | + | NZ_CP040428.1 | Jejubacter calystegiae |
| 48 | 771364 | 771684 | + | NZ_CP034036.1 | Brenneria nigrifluens DSM 30175 = ATCC 13028 |
| 49 | 3464970 | 3465218 | + | NZ_CP011104.1 | Photorhabdus thracensis |
| 50 | 713373 | 713693 | + | NZ_LR134340.1 | Escherichia marmotae |
| 51 | 783505 | 783792 | + | NZ_CP012257.1 | Cronobacter universalis NCTC 9529 |
| 52 | 5035374 | 5035643 | - | NZ_CP051548.1 | Phytobacter diazotrophicus |
| 53 | 3761162 | 3761431 | - | NZ_CP011602.1 | Phytobacter ursingii |
| 54 | 3502623 | 3502943 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 55 | 3646548 | 3646868 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 56 | 89695 | 90015 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 57 | 91077 | 91397 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 58 | 92400 | 92720 | + | NZ_AP014857.1 | Escherichia albertii |
| 59 | 95683 | 96003 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 60 | 2289063 | 2289332 | - | NZ_CP045300.1 | Kosakonia arachidis |
| 61 | 4503712 | 4503981 | - | NZ_CP014007.2 | Kosakonia oryzae |
| 62 | 583804 | 584073 | + | NZ_CP015113.1 | Kosakonia radicincitans |
| 63 | 3846496 | 3846765 | - | NZ_CP054058.1 | Scandinavium goeteborgense |
| 64 | 2647347 | 2647634 | - | NZ_CP027107.1 | Cronobacter sakazakii |
| 65 | 3261292 | 3261579 | - | NZ_CP012268.1 | Cronobacter muytjensii ATCC 51329 |
| 66 | 3395085 | 3395372 | - | NZ_CP013940.1 | Cronobacter malonaticus LMG 23826 |
| 67 | 963330 | 963599 | - | NZ_CP042941.1 | Atlantibacter hermannii |
| 68 | 786079 | 786366 | + | NZ_CP012266.1 | Cronobacter dublinensis subsp. dublinensis LMG 23823 |
| 69 | 4987572 | 4987859 | - | NZ_CP036175.1 | Klebsiella huaxiensis |
| 70 | 3063005 | 3063274 | - | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 71 | 791673 | 791960 | + | NZ_CP012264.1 | Cronobacter condimenti 1330 |
| 72 | 4309465 | 4309761 | - | NZ_LR134475.1 | Klebsiella aerogenes |
| 73 | 2727563 | 2727832 | + | NZ_CP053416.1 | Salmonella bongori |
| 74 | 808906 | 809175 | + | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 75 | 2587298 | 2587567 | - | NZ_CP038469.1 | Citrobacter tructae |
| 76 | 141441 | 141710 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 77 | 1519150 | 1519419 | - | NZ_CP044098.1 | Citrobacter portucalensis |
| 78 | 3537374 | 3537643 | + | NZ_CP033744.1 | Citrobacter freundii |
| 79 | 1879055 | 1879324 | + | NZ_CP020388.1 | Pluralibacter gergoviae |
| 80 | 4363198 | 4363485 | - | NZ_CP065838.1 | Klebsiella quasipneumoniae |
| 81 | 851823 | 852110 | + | NC_016845.1 | Klebsiella pneumoniae subsp. pneumoniae HS11286 |
| 82 | 4637419 | 4637706 | - | NZ_CP054254.1 | Klebsiella variicola |
| 83 | 5099786 | 5100073 | - | NZ_CP060111.1 | Klebsiella michiganensis |
| 84 | 4420853 | 4421149 | - | NZ_CP041247.1 | Raoultella electrica |
| 85 | 2593355 | 2593651 | + | NZ_CP026047.1 | Raoultella planticola |
| 86 | 4638653 | 4638949 | - | NZ_CP046672.1 | Raoultella ornithinolytica |
| 87 | 4749130 | 4749426 | - | NZ_CP050508.1 | Raoultella terrigena |
| 88 | 3765476 | 3765796 | - | NC_017554.1 | Pantoea ananatis PA13 |
| 89 | 2272953 | 2273222 | - | NZ_CP016337.1 | Kosakonia sacchari |
| 90 | 800585 | 800854 | + | NZ_CP063425.1 | Kosakonia pseudosacchari |
| 91 | 3886274 | 3886543 | - | NZ_CP035129.1 | Kosakonia cowanii |
| 92 | 3372931 | 3373218 | - | NC_017910.1 | Shimwellia blattae DSM 4481 = NBRC 105725 |
| 93 | 3843019 | 3843306 | - | NZ_LR134201.1 | Cedecea lapagei |
| 94 | 3848187 | 3848507 | - | NZ_CP006569.1 | Sodalis praecaptivus |
| 95 | 818274 | 818594 | + | NZ_CP061511.1 | Mixta calida |
| 96 | 934781 | 935101 | + | NZ_CP026377.1 | Mixta gaviniae |
| 97 | 4017353 | 4017622 | - | NZ_CP013990.1 | Leclercia adecarboxylata |
| 98 | 3625474 | 3625794 | + | NZ_CP049115.1 | Pantoea stewartii |
| 99 | 4126369 | 4126611 | - | NZ_CP023525.1 | Cedecea neteri |
| 100 | 803883 | 804203 | + | NZ_LN907827.1 | Erwinia gerundensis |
| 101 | 691098 | 691418 | + | NZ_CP034148.1 | Pantoea agglomerans |
| 102 | 3414730 | 3415050 | - | NZ_CP045720.1 | Pantoea eucalypti |
| 103 | 3353550 | 3353870 | - | NZ_CP038853.1 | Pantoea vagans |
| 104 | 2916535 | 2916855 | + | NZ_CP011078.1 | Yersinia ruckeri |
| 105 | 508005 | 508325 | + | NZ_CP065534.1 | Lonsdalea populi |
| 106 | 22818 | 23138 | + | NZ_CP028271.1 | Mixta intestinalis |
| 107 | 3492828 | 3493148 | + | NZ_CP009781.1 | Yersinia aldovae 670-83 |
| 108 | 2450285 | 2450602 | + | NZ_CP007230.1 | Yersinia similis |
| 109 | 521583 | 521903 | - | NZ_CP023009.1 | Lonsdalea britannica |
| 110 | 755551 | 755820 | + | NZ_AP022508.1 | Enterobacter bugandensis |
| 111 | 2784480 | 2784749 | - | NZ_CP045769.1 | Enterobacter cancerogenus |
| 112 | 2316112 | 2316381 | + | NZ_LT556085.1 | Citrobacter amalonaticus |
| 113 | 106894 | 107163 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 114 | 4808781 | 4809050 | - | NZ_CP045205.1 | Citrobacter telavivensis |
| 115 | 731293 | 731562 | + | NZ_CP027986.1 | Enterobacter sichuanensis |
| 116 | 754138 | 754407 | + | NZ_CP017184.1 | Enterobacter roggenkampii |
| 117 | 1776842 | 1777111 | - | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
| 118 | 776608 | 776877 | + | NZ_CP009756.1 | Enterobacter cloacae |
| 119 | 3895257 | 3895526 | + | NZ_CP017279.1 | Enterobacter ludwigii |
| 120 | 882713 | 882982 | + | NZ_CP043318.1 | Enterobacter chengduensis |
| 121 | 4176580 | 4176849 | + | NZ_CP023529.1 | Lelliottia amnigena |
| 122 | 3286017 | 3286286 | + | NZ_AP019007.1 | Enterobacter oligotrophicus |
| 123 | 734780 | 735049 | + | NC_015968.1 | Enterobacter soli |
| 124 | 2765339 | 2765659 | - | NZ_CP029185.2 | Limnobaculum parvum |
| 125 | 3860464 | 3860733 | - | NZ_CP045845.1 | Kluyvera intermedia |
| 126 | 4311633 | 4311905 | - | NC_005126.1 | Photorhabdus laumondii subsp. laumondii TTO1 |
| 127 | 2389417 | 2389734 | - | NZ_CP016176.1 | Xenorhabdus hominickii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP067057.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF10369.11 | 0.91 | 115 | 3291.0 | same-strand | Small subunit of acetolactate synthase |
| 2 | PF01842.27 | 0.91 | 115 | 3291.0 | same-strand | ACT domain |
| 3 | PF13710.8 | 0.91 | 115 | 3291.0 | same-strand | ACT domain |
| 4 | PF13291.8 | 0.91 | 115 | 3291.0 | same-strand | ACT domain |
| 5 | PF00356.23 | 0.98 | 123 | 2107.5 | same-strand | Bacterial regulatory proteins, lacI family |
| 6 | PF00532.23 | 0.88 | 111 | 2108.0 | same-strand | Periplasmic binding proteins and sugar binding domain of LacI family |
| 7 | PF13407.8 | 0.67 | 84 | 2105 | same-strand | Periplasmic binding protein domain |
| 8 | PF13377.8 | 0.97 | 122 | 2108 | same-strand | Periplasmic binding protein-like domain |
| 9 | PF02381.20 | 1.0 | 126 | 985 | same-strand | MraZ protein, putative antitoxin-like |
| 10 | PF01795.21 | 1.0 | 126 | 42 | same-strand | MraW methylase family |
| 11 | PF00905.24 | 1.0 | 126 | 16 | same-strand | Penicillin binding protein transpeptidase domain |
| 12 | PF03717.17 | 1.0 | 126 | 16 | same-strand | Penicillin-binding Protein dimerisation domain |
| 13 | PF08245.14 | 1.0 | 126 | 3256 | same-strand | Mur ligase middle domain |
| 14 | PF02875.23 | 1.0 | 126 | 3253 | same-strand | Mur ligase family, glutamate ligase domain |
| 15 | PF01225.27 | 1.0 | 126 | 1779 | same-strand | Mur ligase family, catalytic domain |
| 16 | PF00953.23 | 1.0 | 126 | 4611 | same-strand | Glycosyl transferase family 4 |
| 17 | PF10555.11 | 1.0 | 126 | 4611 | same-strand | Phospho-N-acetylmuramoyl-pentapeptide-transferase signature 1 |
| 18 | PF02776.20 | 0.63 | 79 | 3772.5 | same-strand | Thiamine pyrophosphate enzyme, N-terminal TPP binding domain |
| 19 | PF00205.24 | 0.63 | 79 | 3772.5 | same-strand | Thiamine pyrophosphate enzyme, central domain |
| 20 | PF02775.23 | 0.63 | 79 | 3772.5 | same-strand | Thiamine pyrophosphate enzyme, C-terminal TPP binding domain |
++ More..