Result : E2JKY7
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | mgtA leader peptide (Regulatory leader peptide for mgtA) |
| NCBI Accession ID | U00096.3 |
| Organism | Escherichia coli (strain K12) |
| Left | 4467431 |
| Right | 4467484 |
| Strand | + |
| Nucleotide Sequence | ATGGAACCTGATCCCACGCCTCTCCCTCGACGGAGATTAAAACTTTTCCGGTAA |
| Sequence | MEPDPTPLPRRRLKLFR |
| Source of smORF | Swiss-Prot |
| Function | Makes mgtA transcription sensitive to intracellular proline levels. Under low levels of proline this protein cannot be fully translated, and a stem loop forms which permits transcription of the downstream mgtA gene (By similarity). {ECO:0000250}. |
| Pubmed ID | 9278503 16738553 |
| Domain | |
| Functional Category | Others |
| Uniprot ID | E2JKY7 |
| ORF Length (Amino Acid) | 17 |
++ More..
| Conservation Analysis |
No. of Species: 13
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4419633 | 4419686 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 2 | 4467431 | 4467484 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 5323096 | 5323149 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 4 | 3993121 | 3993174 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 507020 | 507073 | + | NZ_LR134340.1 | Escherichia marmotae |
| 6 | 4514038 | 4514091 | + | NZ_AP014857.1 | Escherichia albertii |
| 7 | 3496775 | 3496828 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 8 | 2819236 | 2819289 | - | NZ_CP038469.1 | Citrobacter tructae |
| 9 | 3287432 | 3287485 | + | NZ_CP033744.1 | Citrobacter freundii |
| 10 | 4699512 | 4699565 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 11 | 4304645 | 4304698 | - | NZ_CP013990.1 | Leclercia adecarboxylata |
| 12 | 1149896 | 1149949 | + | NZ_CP045205.1 | Citrobacter telavivensis |
| 13 | 524936 | 524989 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
| 14 | 1809216 | 1809269 | - | NZ_CP044098.1 | Citrobacter portucalensis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP061527.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01042.23 | 1.0 | 13 | 5329.5 | opposite-strand | Endoribonuclease L-PSP |
| 2 | PF00122.22 | 1.0 | 13 | 143.0 | same-strand | E1-E2 ATPase |
| 3 | PF00702.28 | 1.0 | 13 | 143.0 | same-strand | haloacid dehalogenase-like hydrolase |
| 4 | PF00690.28 | 0.92 | 12 | 143 | same-strand | Cation transporter/ATPase, N-terminus |
| 5 | PF00689.23 | 0.92 | 12 | 143 | same-strand | Cation transporting ATPase, C-terminus |
| 6 | PF00356.23 | 1.0 | 13 | 190.0 | opposite-strand | Bacterial regulatory proteins, lacI family |
| 7 | PF13377.8 | 1.0 | 13 | 190.0 | opposite-strand | Periplasmic binding protein-like domain |
| 8 | PF00532.23 | 0.92 | 12 | 190 | opposite-strand | Periplasmic binding proteins and sugar binding domain of LacI family |
| 9 | PF02378.20 | 0.92 | 12 | 1252 | opposite-strand | Phosphotransferase system, EIIC |
| 10 | PF00367.22 | 1.0 | 13 | 1260.5 | opposite-strand | phosphotransferase system, EIIB |
| 11 | PF00128.26 | 1.0 | 13 | 2729.0 | opposite-strand | Alpha amylase, catalytic domain |
| 12 | PF11941.10 | 1.0 | 13 | 2729.0 | opposite-strand | Domain of unknown function (DUF3459) |
| 13 | PF13597.8 | 0.85 | 11 | 4772.0 | opposite-strand | Anaerobic ribonucleoside-triphosphate reductase |
| 14 | PF01228.23 | 0.85 | 11 | 4772.0 | opposite-strand | Glycine radical |
| 15 | PF03477.18 | 0.85 | 11 | 4772.0 | opposite-strand | ATP cone domain |
| 16 | PF13353.8 | 0.69 | 9 | 7083.0 | opposite-strand | 4Fe-4S single cluster domain |
| 17 | PF13394.8 | 0.69 | 9 | 7083.0 | opposite-strand | 4Fe-4S single cluster domain |
| 18 | PF16657.7 | 0.69 | 9 | 2764 | opposite-strand | Maltogenic Amylase, C-terminal domain |
++ More..