Result : E1WAC5
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Probable acyl carrier protein IacP (ACP) |
| NCBI Accession ID | U40013.1 |
| Organism | Salmonella typhimurium (strain SL1344) |
| Left | 3206 |
| Right | 3454 |
| Strand | + |
| Nucleotide Sequence | ATGAATATGGATATTGAAGCAAGAGTCAAAAAAGTGATCACCTCTTGTATTGCCGTTGATGTTGATAGTATCAATGGTCAGACCCATCTGGTTGAGGATCTTTACGCTGACTCATTGGATTTAATTGATATTGTATTTGGTCTTAGTGAGGAGTTTGACATTAGTTGCAATGAAAACGATCTTCCTGATATGATGACCTTTGCGGATATATGCCGTGTTGTTAAAAAAAGTCTTGAGTCCAGGGTGTAG |
| Sequence | MNMDIEARVKKVITSCIAVDVDSINGQTHLVEDLYADSLDLIDIVFGLSEEFDISCNENDLPDMMTFADICRVVKKSLESRV |
| Source of smORF | Swiss-Prot |
| Function | Acyl carrier protein. {ECO:0000250}. |
| Pubmed ID | 8522512 22538806 |
| Domain | CDD:415812 |
| Functional Category | Others |
| Uniprot ID | E1WAC5 |
| ORF Length (Amino Acid) | 82 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3024419 | 3024667 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 844494 | 844742 | - | NZ_CP053416.1 | Salmonella bongori |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_003197.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00486.30 | 1.0 | 2 | 2539.5 | opposite-strand | Transcriptional regulatory protein, C terminal |
| 2 | PF07719.19 | 1.0 | 2 | 2539.5 | opposite-strand | Tetratricopeptide repeat |
| 3 | PF01464.22 | 1.0 | 2 | 2039.5 | opposite-strand | Transglycosylase SLT domain |
| 4 | PF09119.12 | 1.0 | 2 | 735.0 | same-strand | SicP binding |
| 5 | PF03545.15 | 1.0 | 2 | 735.0 | same-strand | Yersinia virulence determinant (YopE) |
| 6 | PF05932.15 | 1.0 | 2 | 332.0 | same-strand | Tir chaperone protein (CesT) family |
| 7 | PF09052.12 | 1.0 | 2 | 17.0 | same-strand | SipA N-terminal domain |
| 8 | PF06511.13 | 1.0 | 2 | 2123.0 | same-strand | Type III secretion systems tip complex components |
| 9 | PF09599.12 | 1.0 | 2 | 3220.5 | same-strand | Salmonella-Shigella invasin protein C (IpaC SipC) |
| 10 | PF04888.14 | 1.0 | 2 | 4477.5 | same-strand | Secretion system effector C (SseC) like family |
| 11 | PF16535.7 | 1.0 | 2 | 4477.5 | same-strand | Type III cell invasion protein SipB |
| 12 | PF07720.14 | 1.0 | 2 | 6261.5 | same-strand | Tetratricopeptide repeat |
++ More..