ProsmORF-pred
Result : C6FX52
Protein Information
Information Type Description
Protein name Nosiheptide precursor [Cleaved into: Nosiheptide (NOS) (Antibiotic 9671-RP) (Multhiomycin)]
NCBI Accession ID FJ438820.1
Organism Streptomyces actuosus
Left 18668
Right 18820
Strand +
Nucleotide Sequence GTGGACGCTGCACACCTGTCCGACCTGGACATCGACGCTCTCGAGATCTCCGAGTTCCTGGACGAGAGCCGACTGGAGGACAGCGAGGTCGTGGCCAAGGTCATGTCGGCCTCGTGCACCACCTGCGAGTGCTGCTGTTCCTGCTCCTCCTGA
Sequence MDAAHLSDLDIDALEISEFLDESRLEDSEVVAKVMSASCTTCECCCSCSS
Source of smORF Swiss-Prot
Function Inhibits bacterial protein biosynthesis by binding to ribosomes. Specifically, binds to the complex of 23S rRNA and ribosomal protein L11 (RPLK) in the 50S ribosomal subunit. While allowing a weak binding of elongation factor G (EF-G) to the ribosome and subsequent GTP-hydrolysis, probably impairs conformational changes in both the ribosome and EF-G which are necessary for translocation. In vitro, inhibits Gram-positive bacteria S.aureus strain 209P (MIC=0.0009 ug/ml), S.aureus strain 133 (MIC=0.0019 ug/ml), S.aureus strain B3 (MIC=0.003 ug/ml), S.aureus strain Hb (MIC=0.003 ug/ml), M.citreus strain ATCC 8411 (MIC=0.0038 ug/ml), M.lysodeikticus strain ATCC 4698 (MIC=0.003 ug/ml), S.lutea strain ATCC 9341 (MIC=0.0011 ug/ml), S.faecalis strain ATCC 9790 (MIC=0.0007 ug/ml), S.viridans (MIC=0.0065 ug/ml), S.pyogenes hemolyticus strain Dig7 (MIC=0.00028 ug/ml), D.pneumoniae strain Til (MIC=0.00015 ug/ml), N.catrrhalis (MIC=0.0017 ug/ml), L.casei strain ATCC 6633 (MIC=0.003 ug/ml), B.cereus strain ATCC 6630 (MIC=0.0071 ug/ml) and various isolates of L.monocytogenes. In vitro, inhibits Gram-negative bacterium P.multocida strain A125 (MIC=0.0024 ug/ml) but not M.smegmatis strain ATCC 6630, S.typhimurium, A.aerogenes strain ATCC 8308, P.vulgaris, K.pneumoniae strain ATCC 10031, S.marcescens strain A476, P.aeruginosa strain Bass or B.bronchiseptica strain CN387. Does not inhibit Gram-negative bacterium E.coli strain ATCC 9637 but does inhibit purified ribosomes from E.coli. In vivo, has no systemic effect in mice infected with staphylococci or streptococci when applied orally or subcutaneously. Has a local effect in mice infected subcutaneously or intraperitoneally with staphylococci when applied immediately afterwards. Is not toxic to mice. {ECO:0000269|Pubmed:12954336, ECO:0000269|Pubmed:18380436, ECO:0000269|Pubmed:18406324, ECO:0000269|Pubmed:20441189, ECO:0000269|Pubmed:21836384, ECO:0000269|Pubmed:7038038, ECO:0000269|Pubmed:7379912}.
Pubmed ID 19678698 7379912 7038038 12954336 18380436 20441189 21836384 21047073 893891 2584148 18406324
Domain
Functional Category Antimicrobial
Uniprot ID C6FX52
ORF Length (Amino Acid) 50
++ More..