Protein Information |
Information Type | Description |
---|---|
Protein name | Sec-independent protein translocase protein TatA |
NCBI Accession ID | CP001628.1 |
Organism | Micrococcus luteus (strain ATCC 4698 / DSM 20030 / JCM 1464 / NBRC 3333 / NCIMB 9278 / NCTC 2665 / VKM Ac-2230) (Micrococcus lysodeikticus) |
Left | 1290581 |
Right | 1290838 |
Strand | + |
Nucleotide Sequence | ATGGCTGGACTCCAGGGCTGGCAGCTCGTCATCATCATCCTGCTCGCGATCCTGCTCTTCGCGGCGCCGAAGCTGCCCGCAATGGCCCGCAATCTCGGCCAGTCGATGCGCATTTTCTCCTCCGAGGTGAAGCAGATGCGCACGGAGGGCAAAGACGCGAAGGATGAGCGCTCGGGCACCGGCTCCACCGCCGCGGACGAGCCGGTCGAGGGCCGCGTCGTCGATCGCGACGAGACCGACCCGCGCGACCAGCGCTGA |
Sequence | MAGLQGWQLVIIILLAILLFAAPKLPAMARNLGQSMRIFSSEVKQMRTEGKDAKDERSGTGSTAADEPVEGRVVDRDETDPRDQR |
Source of smORF | Swiss-Prot |
Function | Part of the twin-arginine translocation (Tat) system that transports large folded proteins containing a characteristic twin-arginine motif in their signal peptide across membranes. TatA could form the protein-conducting channel of the Tat system. {ECO:0000255|HAMAP-Rule:MF_00236}. |
Pubmed ID | 19948807 |
Domain | |
Functional Category | Others |
Uniprot ID | C5CBV4 |
ORF Length (Amino Acid) | 85 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 1290581 | 1290838 | + | NC_012803.1 | Micrococcus luteus NCTC 2665 |
2 | 2388351 | 2388572 | + | NZ_CP068013.1 | Paenarthrobacter ureafaciens |
3 | 641023 | 641277 | - | NZ_CP018135.1 | Neomicrococcus aestuarii |
4 | 2562989 | 2563243 | + | NZ_CP029642.1 | Arthrobacter dokdonellae |
5 | 1874024 | 1874239 | + | NC_014550.1 | Glutamicibacter arilaitensis Re117 |
6 | 4512021 | 4512272 | - | NZ_CP043474.1 | Mycobacterium grossiae |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF03136.17 | 1.0 | 6 | 3849.5 | same-strand | Pup-ligase protein |
2 | PF00254.30 | 0.83 | 5 | 2575.0 | same-strand | FKBP-type peptidyl-prolyl cis-trans isomerase |
3 | PF13280.8 | 1.0 | 6 | 396 | same-strand | WYL domain |
4 | PF19187.2 | 1.0 | 6 | 235.5 | same-strand | PafC helix-turn-helix domain |
5 | PF00902.20 | 1.0 | 6 | 19.5 | same-strand | Sec-independent protein translocase protein (TatC) |
6 | PF08148.14 | 1.0 | 6 | 955.5 | same-strand | DSHCT (NUC185) domain |
7 | PF00270.31 | 1.0 | 6 | 955.5 | same-strand | DEAD/DEAH box helicase |
8 | PF04851.17 | 1.0 | 6 | 955.5 | same-strand | Type III restriction enzyme, res subunit |
9 | PF00535.28 | 0.83 | 5 | 5770 | same-strand | Glycosyl transferase family 2 |
10 | PF13397.8 | 0.67 | 4 | 6628.5 | opposite-strand | RNA polymerase-binding protein |
11 | PF07969.13 | 0.67 | 4 | 3959.0 | same-strand | Amidohydrolase family |
12 | PF13641.8 | 0.67 | 4 | 5868.0 | same-strand | Glycosyltransferase like family 2 |