Result : C5CBV4
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Sec-independent protein translocase protein TatA |
| NCBI Accession ID | CP001628.1 |
| Organism | Micrococcus luteus (strain ATCC 4698 / DSM 20030 / JCM 1464 / NBRC 3333 / NCIMB 9278 / NCTC 2665 / VKM Ac-2230) (Micrococcus lysodeikticus) |
| Left | 1290581 |
| Right | 1290838 |
| Strand | + |
| Nucleotide Sequence | ATGGCTGGACTCCAGGGCTGGCAGCTCGTCATCATCATCCTGCTCGCGATCCTGCTCTTCGCGGCGCCGAAGCTGCCCGCAATGGCCCGCAATCTCGGCCAGTCGATGCGCATTTTCTCCTCCGAGGTGAAGCAGATGCGCACGGAGGGCAAAGACGCGAAGGATGAGCGCTCGGGCACCGGCTCCACCGCCGCGGACGAGCCGGTCGAGGGCCGCGTCGTCGATCGCGACGAGACCGACCCGCGCGACCAGCGCTGA |
| Sequence | MAGLQGWQLVIIILLAILLFAAPKLPAMARNLGQSMRIFSSEVKQMRTEGKDAKDERSGTGSTAADEPVEGRVVDRDETDPRDQR |
| Source of smORF | Swiss-Prot |
| Function | Part of the twin-arginine translocation (Tat) system that transports large folded proteins containing a characteristic twin-arginine motif in their signal peptide across membranes. TatA could form the protein-conducting channel of the Tat system. {ECO:0000255|HAMAP-Rule:MF_00236}. |
| Pubmed ID | 19948807 |
| Domain | |
| Functional Category | Others |
| Uniprot ID | C5CBV4 |
| ORF Length (Amino Acid) | 85 |
++ More..
| Conservation Analysis |
No. of Species: 6
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1290581 | 1290838 | + | NC_012803.1 | Micrococcus luteus NCTC 2665 |
| 2 | 2388351 | 2388572 | + | NZ_CP068013.1 | Paenarthrobacter ureafaciens |
| 3 | 641023 | 641277 | - | NZ_CP018135.1 | Neomicrococcus aestuarii |
| 4 | 2562989 | 2563243 | + | NZ_CP029642.1 | Arthrobacter dokdonellae |
| 5 | 1874024 | 1874239 | + | NC_014550.1 | Glutamicibacter arilaitensis Re117 |
| 6 | 4512021 | 4512272 | - | NZ_CP043474.1 | Mycobacterium grossiae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP068013.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03136.17 | 1.0 | 6 | 3849.5 | same-strand | Pup-ligase protein |
| 2 | PF00254.30 | 0.83 | 5 | 2575.0 | same-strand | FKBP-type peptidyl-prolyl cis-trans isomerase |
| 3 | PF13280.8 | 1.0 | 6 | 396 | same-strand | WYL domain |
| 4 | PF19187.2 | 1.0 | 6 | 235.5 | same-strand | PafC helix-turn-helix domain |
| 5 | PF00902.20 | 1.0 | 6 | 19.5 | same-strand | Sec-independent protein translocase protein (TatC) |
| 6 | PF08148.14 | 1.0 | 6 | 955.5 | same-strand | DSHCT (NUC185) domain |
| 7 | PF00270.31 | 1.0 | 6 | 955.5 | same-strand | DEAD/DEAH box helicase |
| 8 | PF04851.17 | 1.0 | 6 | 955.5 | same-strand | Type III restriction enzyme, res subunit |
| 9 | PF00535.28 | 0.83 | 5 | 5770 | same-strand | Glycosyl transferase family 2 |
| 10 | PF13397.8 | 0.67 | 4 | 6628.5 | opposite-strand | RNA polymerase-binding protein |
| 11 | PF07969.13 | 0.67 | 4 | 3959.0 | same-strand | Amidohydrolase family |
| 12 | PF13641.8 | 0.67 | 4 | 5868.0 | same-strand | Glycosyltransferase like family 2 |
++ More..