Result : C5B714
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Citrate lyase acyl carrier protein (Citrate lyase gamma chain) |
| NCBI Accession ID | CP001600.2 |
| Organism | Edwardsiella ictaluri (strain 93-146) |
| Left | 239403 |
| Right | 239702 |
| Strand | - |
| Nucleotide Sequence | ATGAAAATAAACCACGCAGCCGTCGCTGGCACCCTTGAGTCGAGCGACGTGATGGTACGCATCGCGCCCATTGAAGACGACCAGGCTCTCGATCTGCAAATCAGCAGCAGCGTCGAAAAACAGTTTGGCGACGCCATCCGCGCCACCGTGCTGGACGTCCTCAACCGTTATCAGGTGCGCGGCATACAGCTGATCGTTGACGATAAAGGTGCGCTTGACTGTGTCCTGCGCGCACGTCTGGAAACCCTGCTGGCGCGCGCCGCCGACCTGGTCAGTCTGCCCTGGGAGGATCGCGCATGA |
| Sequence | MKINHAAVAGTLESSDVMVRIAPIEDDQALDLQISSSVEKQFGDAIRATVLDVLNRYQVRGIQLIVDDKGALDCVLRARLETLLARAADLVSLPWEDRA |
| Source of smORF | Swiss-Prot |
| Function | Covalent carrier of the coenzyme of citrate lyase. {ECO:0000255|HAMAP-Rule:MF_00805}. |
| Pubmed ID | |
| Domain | CDD:414649 |
| Functional Category | Others |
| Uniprot ID | C5B714 |
| ORF Length (Amino Acid) | 99 |
++ More..
| Conservation Analysis |
No. of Species: 99
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 239403 | 239702 | - | NC_012779.2 | Edwardsiella ictaluri 93-146 |
| 2 | 2005413 | 2005712 | - | NZ_CP006664.1 | Edwardsiella anguillarum ET080813 |
| 3 | 1436394 | 1436693 | + | NZ_CP023706.1 | Edwardsiella tarda |
| 4 | 3506017 | 3506316 | + | NZ_CP016043.1 | Edwardsiella hoshinae |
| 5 | 2622459 | 2622755 | + | NZ_CP054058.1 | Scandinavium goeteborgense |
| 6 | 378706 | 379002 | - | NZ_CP050150.1 | Hafnia alvei |
| 7 | 3175583 | 3175879 | - | NZ_CP053416.1 | Salmonella bongori |
| 8 | 936292 | 936588 | + | NZ_CP044098.1 | Citrobacter portucalensis |
| 9 | 686276 | 686572 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 10 | 2864342 | 2864638 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
| 11 | 2346008 | 2346304 | + | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 12 | 4181004 | 4181300 | - | NZ_CP033744.1 | Citrobacter freundii |
| 13 | 4244648 | 4244944 | + | NZ_CP045205.1 | Citrobacter telavivensis |
| 14 | 1290508 | 1290804 | - | NZ_LR134340.1 | Escherichia marmotae |
| 15 | 650487 | 650783 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 16 | 731842 | 732138 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 17 | 1992109 | 1992405 | + | NZ_CP038469.1 | Citrobacter tructae |
| 18 | 694219 | 694515 | - | NC_013716.1 | Citrobacter rodentium ICC168 |
| 19 | 556331 | 556627 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 20 | 622810 | 623106 | - | NZ_AP014857.1 | Escherichia albertii |
| 21 | 2831376 | 2831672 | + | NZ_CP048796.1 | Providencia vermicola |
| 22 | 3472879 | 3473175 | + | NZ_CP023536.1 | Providencia alcalifaciens |
| 23 | 962006 | 962302 | - | NZ_CP031123.2 | Providencia huaxiensis |
| 24 | 3225403 | 3225699 | + | NZ_AP023184.1 | Buttiauxella agrestis |
| 25 | 2396396 | 2396692 | - | NZ_CP029736.1 | Providencia rettgeri |
| 26 | 2761330 | 2761626 | + | NZ_LS483422.1 | Providencia heimbachae |
| 27 | 3366688 | 3366984 | + | NZ_LR134201.1 | Cedecea lapagei |
| 28 | 3092916 | 3093212 | - | NZ_LS483470.1 | Leminorella richardii |
| 29 | 3388819 | 3389115 | - | NZ_LR134531.1 | Pragia fontium |
| 30 | 3614142 | 3614438 | - | NZ_CP034752.1 | Jinshanibacter zhutongyuii |
| 31 | 5518302 | 5518610 | - | NZ_CP011254.1 | Serratia fonticola |
| 32 | 3194845 | 3195141 | - | NZ_CP029185.2 | Limnobaculum parvum |
| 33 | 1701456 | 1701764 | + | NZ_CP071320.1 | Serratia ureilytica |
| 34 | 3509467 | 3509775 | - | NC_015567.1 | Serratia plymuthica AS9 |
| 35 | 2682140 | 2682448 | - | NZ_CP016948.1 | Serratia surfactantfaciens |
| 36 | 3384437 | 3384745 | - | NZ_CP038662.1 | Serratia nematodiphila |
| 37 | 3443109 | 3443417 | - | NZ_CP048784.1 | Serratia liquefaciens |
| 38 | 2913137 | 2913430 | - | NZ_CP011118.1 | Yersinia enterocolitica |
| 39 | 3436557 | 3436865 | - | NZ_LT906479.1 | Serratia ficaria |
| 40 | 187371 | 187667 | + | NZ_CP009787.1 | Yersinia rohdei |
| 41 | 309366 | 309674 | - | NZ_CP014136.1 | Gibbsiella quercinecans |
| 42 | 1728326 | 1728619 | + | NZ_CP014136.1 | Gibbsiella quercinecans |
| 43 | 1775809 | 1776102 | + | NZ_CP046293.1 | Yersinia intermedia |
| 44 | 867670 | 867963 | - | NZ_CP011078.1 | Yersinia ruckeri |
| 45 | 2922593 | 2922886 | - | NZ_CP043727.1 | Yersinia canariae |
| 46 | 2381584 | 2381877 | - | NZ_CP032487.1 | Yersinia hibernica |
| 47 | 4716737 | 4717045 | - | NZ_CP065640.1 | Serratia rubidaea |
| 48 | 3044891 | 3045184 | + | NZ_CP054043.1 | Yersinia mollaretii ATCC 43969 |
| 49 | 27254 | 27550 | + | NZ_CP009781.1 | Yersinia aldovae 670-83 |
| 50 | 3492724 | 3493005 | - | NZ_LR134494.1 | Serratia quinivorans |
| 51 | 5878884 | 5879177 | + | NZ_CP036175.1 | Klebsiella huaxiensis |
| 52 | 1521706 | 1521993 | + | NZ_CP015425.1 | [Haemophilus] ducreyi |
| 53 | 940443 | 940730 | + | NZ_CP006954.1 | Bibersteinia trehalosi USDA-ARS-USMARC-188 |
| 54 | 1912505 | 1912792 | - | NZ_CP029206.1 | Actinobacillus porcitonsillarum |
| 55 | 558808 | 559095 | + | NZ_LR134510.1 | Actinobacillus delphinicola |
| 56 | 1072382 | 1072669 | + | NZ_CP009610.1 | Haemophilus influenzae |
| 57 | 1876239 | 1876526 | - | NZ_LS483429.1 | Haemophilus aegyptius |
| 58 | 703947 | 704243 | + | NZ_AP014524.1 | Vibrio cholerae MS6 |
| 59 | 770592 | 770879 | + | NZ_LR134327.1 | Aggregatibacter aphrophilus ATCC 33389 |
| 60 | 447920 | 448216 | + | NZ_CP035688.1 | Vibrio metoecus |
| 61 | 3895612 | 3895902 | - | NZ_CP060111.1 | Klebsiella michiganensis |
| 62 | 2417903 | 2418193 | - | NZ_CP027986.1 | Enterobacter sichuanensis |
| 63 | 3905680 | 3905973 | - | NZ_CP027986.1 | Enterobacter sichuanensis |
| 64 | 931542 | 931829 | - | NZ_CP009159.1 | Actinobacillus suis ATCC 33415 |
| 65 | 4090365 | 4090658 | - | NZ_CP063425.1 | Kosakonia pseudosacchari |
| 66 | 977238 | 977525 | - | NZ_CP007715.1 | Actinobacillus equuli subsp. equuli |
| 67 | 3876614 | 3876907 | + | NZ_CP045300.1 | Kosakonia arachidis |
| 68 | 98991 | 99281 | + | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
| 69 | 3361267 | 3361560 | + | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
| 70 | 49550 | 49846 | - | NZ_CP068420.1 | Gluconobacter sphaericus |
| 71 | 16122 | 16418 | + | NZ_CP014690.1 | Gluconobacter albidus |
| 72 | 7026 | 7319 | + | NZ_CP011602.1 | Phytobacter ursingii |
| 73 | 1336687 | 1336980 | + | NZ_CP051548.1 | Phytobacter diazotrophicus |
| 74 | 3863263 | 3863556 | - | NZ_AP022508.1 | Enterobacter bugandensis |
| 75 | 3804156 | 3804449 | - | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 76 | 730142 | 730435 | + | NZ_CP035129.1 | Kosakonia cowanii |
| 77 | 4302974 | 4303267 | - | NZ_CP023525.1 | Cedecea neteri |
| 78 | 3720949 | 3721221 | - | NZ_CP039126.1 | Blautia producta |
| 79 | 4463658 | 4463951 | + | NZ_CP045769.1 | Enterobacter cancerogenus |
| 80 | 671061 | 671351 | + | NC_017910.1 | Shimwellia blattae DSM 4481 = NBRC 105725 |
| 81 | 2168699 | 2168995 | - | NZ_CP009467.1 | Vibrio harveyi |
| 82 | 2609425 | 2609718 | - | NZ_CP023529.1 | Lelliottia amnigena |
| 83 | 3910312 | 3910605 | + | NZ_CP016337.1 | Kosakonia sacchari |
| 84 | 4856946 | 4857239 | - | NZ_CP040428.1 | Jejubacter calystegiae |
| 85 | 785368 | 785658 | + | NZ_CP046672.1 | Raoultella ornithinolytica |
| 86 | 778560 | 778853 | + | NZ_CP045845.1 | Kluyvera intermedia |
| 87 | 733781 | 734071 | + | NZ_CP041247.1 | Raoultella electrica |
| 88 | 3933202 | 3933495 | - | NZ_CP017184.1 | Enterobacter roggenkampii |
| 89 | 4454483 | 4454776 | + | NZ_CP017279.1 | Enterobacter ludwigii |
| 90 | 4004726 | 4005019 | - | NZ_CP009756.1 | Enterobacter cloacae |
| 91 | 4263349 | 4263642 | - | NZ_CP043318.1 | Enterobacter chengduensis |
| 92 | 2651555 | 2651851 | - | NC_007908.1 | Rhodoferax ferrireducens T118 |
| 93 | 2223089 | 2223355 | - | NZ_CP022413.2 | Blautia hansenii DSM 20583 |
| 94 | 2295353 | 2295625 | - | NZ_CP030280.1 | Blautia argi |
| 95 | 1657360 | 1657653 | - | NZ_AP019007.1 | Enterobacter oligotrophicus |
| 96 | 3603007 | 3603300 | - | NZ_CP012257.1 | Cronobacter universalis NCTC 9529 |
| 97 | 357365 | 357658 | + | NZ_CP012268.1 | Cronobacter muytjensii ATCC 51329 |
| 98 | 909510 | 909800 | - | NZ_CP026047.1 | Raoultella planticola |
| 99 | 3780043 | 3780336 | - | NZ_CP012266.1 | Cronobacter dublinensis subsp. dublinensis LMG 23823 |
| 100 | 1583004 | 1583294 | - | NZ_LR134365.1 | Cardiobacterium hominis |
| 101 | 2107336 | 2107632 | - | NZ_CP017111.1 | Sulfurospirillum halorespirans DSM 13726 |
| 102 | 2258877 | 2259173 | - | NZ_CP007201.1 | Sulfurospirillum multivorans DSM 12446 |
| 103 | 786341 | 786628 | + | NC_016845.1 | Klebsiella pneumoniae subsp. pneumoniae HS11286 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP006664.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01874.18 | 0.97 | 96 | 2941 | same-strand | ATP:dephospho-CoA triphosphoribosyl transferase |
| 2 | PF03802.16 | 0.94 | 93 | 2418 | same-strand | Apo-citrate lyase phosphoribosyl-dephospho-CoA transferase |
| 3 | PF03328.16 | 1.0 | 99 | -3 | same-strand | HpcH/HpaI aldolase/citrate lyase family |
| 4 | PF08218.13 | 0.93 | 92 | 16.5 | same-strand | Citrate lyase ligase C-terminal domain |
| 5 | PF02518.28 | 0.67 | 66 | 2563.0 | opposite-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
| 6 | PF14501.8 | 0.67 | 66 | 1503 | opposite-strand | GHKL domain |
| 7 | PF00072.26 | 0.77 | 76 | 3192.0 | opposite-strand | Response regulator receiver domain |
| 8 | PF12431.10 | 0.65 | 64 | 3095.5 | opposite-strand | Transcriptional regulator |
| 9 | PF04223.14 | 0.99 | 98 | 895.5 | same-strand | Citrate lyase, alpha subunit (CitF) |
++ More..