Protein Information |
Information Type | Description |
---|---|
Protein name | YcgL domain-containing protein Maqu_1609 |
NCBI Accession ID | CP000514.1 |
Organism | Marinobacter hydrocarbonoclasticus (strain ATCC 700491 / DSM 11845 / VT8) |
Left | 1803716 |
Right | 1804009 |
Strand | - |
Nucleotide Sequence | ATGACTGAACGCGAATTTGTATCGGTGTTTCGCAGCAGCAAGAAAGGCGACACCTATCTCTTTGTCCGCCGAGGGCAAAAGTGGGACGATTTACCGGAGGCGCTGAGAGGTATCTTTGGTTCGCCCATCCACTCGATGGATCTGCTGCTGACGCCAGACAAGAAGCTCGCGCGCACAACCGGAAAGGAAGTGTTGGCGGCAATTGAGGAAAAGGACTTTTTCCTGCAGATGCCGGAAGAGCAGGACACCTACATAGTCGACTTCAAGCGCAAGATTGAGCAACACCGGAAATGA |
Sequence | MTEREFVSVFRSSKKGDTYLFVRRGQKWDDLPEALRGIFGSPIHSMDLLLTPDKKLARTTGKEVLAAIEEKDFFLQMPEEQDTYIVDFKRKIEQHRK |
Source of smORF | Swiss-Prot |
Function | The ORF matches to the profile of cl22628. Profile Description: YcgL domain. This family of proteins formerly called DUF709 includes the E. coli gene ycgL. homologs of YcgL are found in gammaproteobacteria. The structure of this protein shows a novel alpha/beta/alpha sandwich structure. |
Pubmed ID | |
Domain | CDD:419850 |
Functional Category | Others |
Uniprot ID | A1U124 |
ORF Length (Amino Acid) | 97 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 1985986 | 1986279 | - | NC_017506.1 | Marinobacter adhaerens HP15 |
2 | 1032188 | 1032481 | + | NZ_CP017715.1 | Marinobacter salinus |
3 | 1943012 | 1943305 | + | NZ_CP043042.1 | Marinobacter fonticola |
4 | 2170538 | 2170828 | + | NZ_CP020931.1 | Marinobacter salarius |
5 | 2282052 | 2282348 | - | NZ_CP011494.1 | Marinobacter psychrophilus |
6 | 2257400 | 2257705 | - | NZ_CP031093.1 | Hydrocarboniclastica marina |
7 | 2686462 | 2686728 | + | NC_007645.1 | Hahella chejuensis KCTC 2396 |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00004.31 | 1.0 | 7 | 2352 | same-strand | ATPase family associated with various cellular activities (AAA) |
2 | PF07728.16 | 0.86 | 6 | 3042.5 | same-strand | AAA domain (dynein-related subfamily) |
3 | PF00092.30 | 1.0 | 7 | 857 | same-strand | von Willebrand factor type A domain |
4 | PF13768.8 | 1.0 | 7 | 857 | same-strand | von Willebrand factor type A domain |
5 | PF13519.8 | 0.86 | 6 | 935.0 | same-strand | von Willebrand factor type A domain |
6 | PF03692.17 | 1.0 | 7 | -3 | same-strand | Putative zinc- or iron-chelating domain |
7 | PF00570.25 | 1.0 | 7 | -3 | same-strand | HRDC domain |
8 | PF01612.22 | 1.0 | 7 | -3 | same-strand | 3'-5' exonuclease |
9 | PF13662.8 | 1.0 | 7 | 1186 | same-strand | Toprim domain |
10 | PF02132.17 | 1.0 | 7 | 1186 | same-strand | RecR protein |
11 | PF01751.24 | 1.0 | 7 | 1186 | same-strand | Toprim domain |
12 | PF02575.18 | 1.0 | 7 | 1820 | same-strand | YbaB/EbfC DNA-binding family |
13 | PF13177.8 | 1.0 | 7 | 2164 | same-strand | DNA polymerase III, delta subunit |
14 | PF12169.10 | 1.0 | 7 | 2164 | same-strand | DNA polymerase III subunits gamma and tau domain III |
15 | PF12170.10 | 1.0 | 7 | 2164 | same-strand | DNA polymerase III tau subunit V interacting with alpha |
16 | PF13640.8 | 0.71 | 5 | 4448 | same-strand | 2OG-Fe(II) oxygenase superfamily |
17 | PF13661.8 | 0.71 | 5 | 4448 | same-strand | 2OG-Fe(II) oxygenase superfamily |