Result : C4XS55
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | 30S ribosomal protein S20 |
| NCBI Accession ID | AP010904.1 |
| Organism | Desulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1) |
| Left | 2358080 |
| Right | 2358349 |
| Strand | + |
| Nucleotide Sequence | TTGGCCAACCATAAATCCGCCATCAAACGGCATCGTCAAAACCTTTTGGCCCGGGCTCGCAACCGGGCGGTCAAGACCCGCGTGCGTAACGTCATCAAGGCCGTGCGCGCCGCCCTGATCGGCGGGGACGCCGCTGCCGCCGAAACCGCCCTGCTGACCGCCACCAAGGTGCTCGACAAGGCCGCCACCAAAAAGATCATTCACTGGAAGACCGCCGCCCGCAACATCTCGCGGCTGTCCACTGCCGTCAACAAGGCCAAATCGGCCTAG |
| Sequence | MANHKSAIKRHRQNLLARARNRAVKTRVRNVIKAVRAALIGGDAAAAETALLTATKVLDKAATKKIIHWKTAARNISRLSTAVNKAKSA |
| Source of smORF | Swiss-Prot |
| Function | Binds directly to 16S ribosomal RNA. {ECO:0000255|HAMAP-Rule:MF_00500}. |
| Pubmed ID | 19675025 |
| Domain | CDD:412349 |
| Functional Category | Ribosomal_protein |
| Uniprot ID | C4XS55 |
| ORF Length (Amino Acid) | 89 |
++ More..
| Conservation Analysis |
No. of Species: 81
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2358080 | 2358349 | + | NC_012796.1 | Desulfovibrio magneticus RS-1 |
| 2 | 2302116 | 2302385 | + | NZ_CP026538.1 | Desulfovibrio carbinolicus |
| 3 | 1035246 | 1035515 | - | NZ_CP045504.1 | Desulfovibrio sulfodismutans DSM 3696 |
| 4 | 1813527 | 1813796 | + | NZ_CP045508.1 | Desulfolutivibrio sulfoxidireducens |
| 5 | 958414 | 958686 | - | NZ_CP039543.1 | Desulfovibrio marinus |
| 6 | 3021214 | 3021483 | + | NC_016629.1 | Desulfocurvibacter africanus subsp. africanus str. Walvis Bay |
| 7 | 963775 | 964038 | + | NZ_AP017378.1 | Desulfovibrio ferrophilus |
| 8 | 1612859 | 1613122 | + | NC_017310.1 | Desulfovibrio vulgaris RCH1 |
| 9 | 1937215 | 1937478 | - | NC_013223.1 | Desulfohalobium retbaense DSM 5692 |
| 10 | 1081433 | 1081693 | + | NC_013173.1 | Desulfomicrobium baculatum DSM 4028 |
| 11 | 1718846 | 1719106 | + | NZ_CP014230.1 | Desulfomicrobium orale DSM 12838 |
| 12 | 826668 | 826934 | - | NZ_LT907975.1 | Pseudodesulfovibrio profundus |
| 13 | 2071299 | 2071562 | - | NC_007519.1 | Desulfovibrio alaskensis G20 |
| 14 | 374857 | 375129 | - | NC_020127.1 | Lawsonia intracellularis N343 |
| 15 | 407732 | 407995 | + | NC_016803.1 | Pseudodesulfovibrio mercurii |
| 16 | 2167323 | 2167586 | - | NC_012881.1 | Maridesulfovibrio salexigens DSM 2638 |
| 17 | 1914759 | 1915025 | - | NC_014844.1 | Pseudodesulfovibrio aespoeensis Aspo-2 |
| 18 | 3132850 | 3133116 | - | NZ_CP046400.1 | Pseudodesulfovibrio cashew |
| 19 | 1028183 | 1028452 | + | NZ_CP014229.1 | Desulfovibrio fairfieldensis |
| 20 | 532193 | 532456 | - | NZ_CP015519.1 | Syntrophotalea acetylenivorans |
| 21 | 2147673 | 2147936 | + | NZ_CP009245.1 | Corynebacterium aquilae DSM 44791 |
| 22 | 231177 | 231437 | - | NZ_CP019070.1 | Poseidonibacter parvus |
| 23 | 1955320 | 1955586 | + | NZ_CP061799.1 | Desulfonema limicola |
| 24 | 163420 | 163683 | - | NZ_AP021875.1 | Desulfosarcina widdelii |
| 25 | 812558 | 812824 | + | NZ_CP014646.1 | Thauera humireducens |
| 26 | 2469598 | 2469864 | - | NZ_CP016210.1 | Azoarcus olearius |
| 27 | 82526 | 82789 | - | NZ_AP021874.1 | Desulfosarcina alkanivorans |
| 28 | 101652 | 101918 | - | NC_014762.1 | Sulfuricurvum kujiense DSM 16994 |
| 29 | 2717131 | 2717397 | + | NZ_CP018839.1 | Thauera chlorobenzoica |
| 30 | 1790002 | 1790268 | + | NZ_CP028339.1 | Thauera aromatica K172 |
| 31 | 774078 | 774353 | - | NC_005090.1 | Wolinella succinogenes DSM 1740 |
| 32 | 126554 | 126829 | - | NZ_CP017111.1 | Sulfurospirillum halorespirans DSM 13726 |
| 33 | 129052 | 129327 | - | NZ_CP007201.1 | Sulfurospirillum multivorans DSM 12446 |
| 34 | 2931312 | 2931575 | + | NZ_CP036278.1 | Aeoliella mucimassa |
| 35 | 2540306 | 2540581 | - | NZ_CP012109.1 | Myxococcus hansupus |
| 36 | 1711375 | 1711641 | - | NZ_CP029331.1 | Thauera hydrothermalis |
| 37 | 4035097 | 4035363 | - | NZ_CP068053.1 | Peribacillus psychrosaccharolyticus |
| 38 | 5850088 | 5850363 | + | NZ_CP022203.1 | Corallococcus macrosporus DSM 14697 |
| 39 | 1584105 | 1584371 | - | NC_014365.1 | Desulfarculus baarsii DSM 2075 |
| 40 | 3257594 | 3257860 | + | NC_014624.2 | Eubacterium callanderi |
| 41 | 4112589 | 4112855 | - | NZ_CP029487.1 | Eubacterium maltosivorans |
| 42 | 1925137 | 1925403 | - | NZ_CP019962.1 | Eubacterium limosum |
| 43 | 1466505 | 1466774 | + | NZ_AP023212.1 | Hydrogenimonas urashimensis |
| 44 | 2068982 | 2069245 | + | NZ_CP010802.1 | Desulfuromonas soudanensis |
| 45 | 1807504 | 1807770 | + | NZ_CP008876.1 | Terribacillus goriensis |
| 46 | 1637645 | 1637905 | + | NZ_CP031423.1 | Microbacterium lemovicicum |
| 47 | 1347663 | 1347923 | - | NC_015671.1 | Cellulomonas gilvus ATCC 13127 |
| 48 | 1071485 | 1071745 | - | NZ_CP058670.1 | Chryseoglobus indicus |
| 49 | 2529646 | 2529909 | + | NZ_AP021876.1 | Desulfosarcina ovata subsp. sediminis |
| 50 | 5024281 | 5024553 | + | NZ_CP013480.3 | Pandoraea norimbergensis |
| 51 | 3906739 | 3907008 | + | NZ_CP029176.1 | Acidibrevibacterium fodinaquatile |
| 52 | 1249222 | 1249494 | - | NZ_CP013481.2 | Pandoraea apista |
| 53 | 1673784 | 1674044 | + | NZ_LS483423.1 | Jonesia denitrificans |
| 54 | 2604170 | 2604433 | + | NC_007517.1 | Geobacter metallireducens GS-15 |
| 55 | 5512282 | 5512554 | + | NZ_CP012333.1 | Labilithrix luteola |
| 56 | 1195448 | 1195717 | - | NZ_CP042808.1 | Acetobacter oryzoeni |
| 57 | 1976 | 2245 | - | NC_021991.1 | Acetobacter pasteurianus 386B |
| 58 | 851534 | 851803 | - | NZ_CP015164.1 | Acetobacter ascendens |
| 59 | 1325514 | 1325783 | - | NZ_CP022374.1 | Acetobacter oryzifermentans |
| 60 | 1266104 | 1266364 | - | NZ_CP031421.1 | Microbacterium oleivorans |
| 61 | 1234984 | 1235244 | - | NZ_CP031421.1 | Microbacterium oleivorans |
| 62 | 847511 | 847771 | + | NZ_CP028106.1 | Fusobacterium gonidiaformans ATCC 25563 |
| 63 | 1940508 | 1940780 | - | NZ_CP024699.1 | Fusobacterium pseudoperiodonticum |
| 64 | 2008057 | 2008317 | + | NZ_CP038266.1 | Microbacterium wangchenii |
| 65 | 1951683 | 1951943 | + | NZ_CP044232.1 | Microbacterium lushaniae |
| 66 | 3700429 | 3700692 | + | NC_009483.1 | Geobacter uraniireducens Rf4 |
| 67 | 2481518 | 2481778 | + | NC_014151.1 | Cellulomonas flavigena DSM 20109 |
| 68 | 4161222 | 4161500 | + | NZ_AP021861.1 | Lacipirellula parvula |
| 69 | 3472101 | 3472361 | - | NZ_CP035806.1 | Leucobacter triazinivorans |
| 70 | 1808004 | 1808264 | + | NZ_CP044231.1 | Microbacterium caowuchunii |
| 71 | 5941802 | 5942077 | + | NC_008095.1 | Myxococcus xanthus DK 1622 |
| 72 | 2845409 | 2845669 | - | NZ_CP049255.1 | Microbacterium endophyticum |
| 73 | 1909157 | 1909429 | - | NZ_CP047385.1 | Pandoraea fibrosis |
| 74 | 4457333 | 4457605 | + | NZ_CP011253.3 | Pandoraea oxalativorans |
| 75 | 4577942 | 4578214 | + | NZ_LT906435.1 | Pandoraea sputorum |
| 76 | 2245421 | 2245684 | - | NZ_CP022464.2 | Enterocloster bolteae |
| 77 | 602315 | 602584 | + | NZ_CP047156.1 | Epidermidibacterium keratini |
| 78 | 1264216 | 1264476 | + | NZ_CP028130.1 | Rathayibacter iranicus |
| 79 | 622689 | 622949 | - | NZ_CP007490.1 | Rhodoluna lacicola |
| 80 | 2889537 | 2889806 | - | NZ_CP016022.1 | Ralstonia insidiosa |
| 81 | 1898938 | 1899198 | - | NZ_CP018762.1 | Microbacterium aurum |
| 82 | 1674015 | 1674281 | - | NC_013757.1 | Geodermatophilus obscurus DSM 43160 |
++ More..