Result : C4XLZ1
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | 50S ribosomal protein L30 |
| NCBI Accession ID | AP010904.1 |
| Organism | Desulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1) |
| Left | 1348724 |
| Right | 1348903 |
| Strand | + |
| Nucleotide Sequence | ATGGCAAACATTACCGTCAAGCTGGTGAGAAGCCGCTACGGCAACACGCCCAAGCAGCGCGCCACCCTGGCTTCCCTTGGCCTGAAGAAAATCCGCCAGGAACGCTCCTTCGAGAAAACCGACACTCTGGTCGGCATGATCGCGAAGGTCCAACATCTCGTTGAGGTGACCGAGTCATGA |
| Sequence | MANITVKLVRSRYGNTPKQRATLASLGLKKIRQERSFEKTDTLVGMIAKVQHLVEVTES |
| Source of smORF | Swiss-Prot |
| Function | The ORF matches to the profile of cl00203. Profile Description: N/A. This family includes prokaryotic L30 and eukaryotic L7. |
| Pubmed ID | 19675025 |
| Domain | CDD:412218 |
| Functional Category | Ribosomal_protein |
| Uniprot ID | C4XLZ1 |
| ORF Length (Amino Acid) | 59 |
++ More..
| Conservation Analysis |
No. of Species: 66
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3388143 | 3388322 | - | NZ_CP026538.1 | Desulfovibrio carbinolicus |
| 2 | 1348724 | 1348903 | + | NC_012796.1 | Desulfovibrio magneticus RS-1 |
| 3 | 1471566 | 1471748 | - | NZ_CP045504.1 | Desulfovibrio sulfodismutans DSM 3696 |
| 4 | 1266480 | 1266638 | + | NZ_CP045508.1 | Desulfolutivibrio sulfoxidireducens |
| 5 | 1327938 | 1328084 | + | NC_012881.1 | Maridesulfovibrio salexigens DSM 2638 |
| 6 | 2344877 | 2345059 | - | NC_013223.1 | Desulfohalobium retbaense DSM 5692 |
| 7 | 2274503 | 2274673 | - | NC_007519.1 | Desulfovibrio alaskensis G20 |
| 8 | 448383 | 448559 | + | NZ_AP017378.1 | Desulfovibrio ferrophilus |
| 9 | 2456334 | 2456501 | + | NC_016629.1 | Desulfocurvibacter africanus subsp. africanus str. Walvis Bay |
| 10 | 1404956 | 1405126 | + | NC_017310.1 | Desulfovibrio vulgaris RCH1 |
| 11 | 2350162 | 2350338 | - | NZ_CP014229.1 | Desulfovibrio fairfieldensis |
| 12 | 1032518 | 1032703 | - | NZ_CP008796.1 | Thermodesulfobacterium commune DSM 2178 |
| 13 | 2450954 | 2451124 | - | NC_014844.1 | Pseudodesulfovibrio aespoeensis Aspo-2 |
| 14 | 4176086 | 4176265 | + | NZ_CP014337.1 | Elizabethkingia bruuniana |
| 15 | 2544095 | 2544274 | - | NZ_CP015067.2 | Elizabethkingia anophelis |
| 16 | 1980258 | 1980437 | + | NZ_LT906465.1 | Chryseobacterium taklimakanense |
| 17 | 28654 | 28839 | - | NZ_CP036523.1 | Peptacetobacter hiranonis |
| 18 | 4175562 | 4175741 | - | NZ_CP020559.1 | Clostridium formicaceticum |
| 19 | 4164428 | 4164610 | + | NZ_CP025791.1 | Flavivirga eckloniae |
| 20 | 1137946 | 1138122 | - | NC_017045.1 | Riemerella anatipestifer ATCC 11845 = DSM 15868 |
| 21 | 567892 | 568071 | + | NC_009922.1 | Alkaliphilus oremlandii OhILAs |
| 22 | 124555 | 124737 | - | NZ_CP069450.1 | Butyricimonas virosa |
| 23 | 3500315 | 3500497 | + | NZ_CP032819.1 | Butyricimonas faecalis |
| 24 | 2738410 | 2738586 | - | NZ_CP050995.1 | Chryseobacterium gallinarum |
| 25 | 4025194 | 4025370 | - | NZ_CP033914.1 | Chryseobacterium shandongense |
| 26 | 1703925 | 1704101 | + | NZ_CP033932.1 | Chryseobacterium bernardetii |
| 27 | 4048465 | 4048641 | + | NZ_LR134289.1 | Chryseobacterium gleum |
| 28 | 221509 | 221694 | - | NZ_CP034437.1 | Paenibacillus albus |
| 29 | 89902 | 90087 | + | NZ_CP014150.1 | Paeniclostridium sordellii |
| 30 | 2605546 | 2605728 | - | NC_015385.1 | Treponema succinifaciens DSM 2489 |
| 31 | 317929 | 318093 | + | NZ_CP039543.1 | Desulfovibrio marinus |
| 32 | 3684434 | 3684610 | + | NZ_CP033926.1 | Chryseobacterium joostei |
| 33 | 703930 | 704106 | + | NZ_LR134386.1 | Chryseobacterium nakagawai |
| 34 | 1839524 | 1839700 | + | NZ_CP033924.1 | Chryseobacterium lactis |
| 35 | 6059549 | 6059734 | + | NZ_AP019308.1 | Paenibacillus baekrokdamisoli |
| 36 | 237652 | 237837 | + | NZ_CP061941.1 | Marinomonas algicola |
| 37 | 1878827 | 1879003 | - | NZ_LR215974.1 | Chryseobacterium taihuense |
| 38 | 751913 | 752089 | + | NZ_CP033929.1 | Chryseobacterium indoltheticum |
| 39 | 2745147 | 2745323 | - | NZ_CP023049.2 | Chryseobacterium piperi |
| 40 | 1510824 | 1511000 | - | NZ_CP015199.1 | Chryseobacterium glaciei |
| 41 | 810931 | 811107 | - | NZ_CP033920.1 | Chryseobacterium carnipullorum |
| 42 | 2795191 | 2795373 | + | NZ_CP011058.1 | Paenibacillus beijingensis |
| 43 | 3729188 | 3729367 | + | NZ_CP035492.1 | Paenibacillus protaetiae |
| 44 | 1009263 | 1009439 | + | NC_014816.1 | Asticcacaulis excentricus CB 48 |
| 45 | 3181067 | 3181243 | + | NZ_CP022986.1 | Chryseobacterium camelliae |
| 46 | 259892 | 260077 | + | NC_015276.1 | Marinomonas mediterranea MMB-1 |
| 47 | 4569404 | 4569583 | - | NC_009633.1 | Alkaliphilus metalliredigens QYMF |
| 48 | 1732240 | 1732404 | - | NZ_CP020468.1 | Actinomyces gaoshouyii |
| 49 | 67755 | 67931 | - | NZ_CP024727.1 | Prevotella intermedia |
| 50 | 1717409 | 1717603 | + | NZ_CP014228.1 | Actinomyces radicidentis |
| 51 | 590283 | 590462 | - | NC_020156.1 | Nonlabens dokdonensis DSW-6 |
| 52 | 572280 | 572444 | + | NZ_CP053642.1 | Actinomyces marmotae |
| 53 | 1613962 | 1614111 | - | NC_012438.1 | Sulfurihydrogenibium azorense Az-Fu1 |
| 54 | 1290609 | 1290773 | - | NZ_LR134350.1 | Actinomyces howellii |
| 55 | 2762862 | 2763026 | - | NZ_CP039292.1 | Actinomyces procaprae |
| 56 | 1410258 | 1410443 | + | NZ_CP059066.1 | Koleobacter methoxysyntrophicus |
| 57 | 178381 | 178542 | - | NZ_CP014525.1 | Haematospirillum jordaniae |
| 58 | 2504092 | 2504274 | - | NZ_CP068055.1 | Sutterella wadsworthensis |
| 59 | 1089997 | 1090173 | - | NZ_CP063145.1 | Cruoricaptor ignavus |
| 60 | 867785 | 867970 | - | NC_016751.1 | Marinitoga piezophila KA3 |
| 61 | 789546 | 789734 | + | NC_013525.1 | Thermobaculum terrenum ATCC BAA-798 |
| 62 | 332734 | 332916 | + | NZ_AP018786.1 | Sutterella megalosphaeroides |
| 63 | 1366348 | 1366530 | - | NZ_CP018622.1 | Virgibacillus dokdonensis |
| 64 | 2025791 | 2025940 | + | NZ_CP040882.1 | Sutterella faecalis |
| 65 | 2252277 | 2252462 | - | NC_014220.1 | Syntrophothermus lipocalidus DSM 12680 |
| 66 | 2981697 | 2981873 | - | NZ_AP022575.1 | Mycobacterium shinjukuense |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP026538.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00416.24 | 0.61 | 40 | 2322.0 | same-strand | Ribosomal protein S13/S18 |
| 2 | PF00344.22 | 0.98 | 65 | 481 | same-strand | SecY |
| 3 | PF00828.21 | 1.0 | 66 | 19.0 | same-strand | Ribosomal proteins 50S-L15, 50S-L18e, 60S-L27A |
| 4 | PF03719.17 | 1.0 | 66 | 13.0 | same-strand | Ribosomal protein S5, C-terminal domain |
| 5 | PF00333.22 | 1.0 | 66 | 13.0 | same-strand | Ribosomal protein S5, N-terminal domain |
| 6 | PF00861.24 | 1.0 | 66 | 549.0 | same-strand | Ribosomal L18 of archaea, bacteria, mitoch. and chloroplast |
| 7 | PF00347.25 | 1.0 | 66 | 921.0 | same-strand | Ribosomal protein L6 |
| 8 | PF00410.21 | 1.0 | 66 | 1484.0 | same-strand | Ribosomal protein S8 |
| 9 | PF00253.23 | 0.86 | 57 | 1952 | same-strand | Ribosomal protein S14p/S29e |
++ More..