Result : A1SZR9
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Cell division protein ZapB |
| NCBI Accession ID | CP000510.1 |
| Organism | Psychromonas ingrahamii (strain 37) |
| Left | 4068888 |
| Right | 4069112 |
| Strand | - |
| Nucleotide Sequence | ATGACATTGGATCTTTTAGAACAGTTAGAAAGTAAAATTCAAAACACGGTAGATACCATTGCGTTGCTGCAAATGGAAGTTGAAGAGCTCAAAGAAGATAAGCAGGTTTTAACTGAAAAAGGTGAGCAGTTACAGGCAGAAAATATCCGATTAACAGAAGAGCACCAGAAATGGCAATCTCGTTTAAGTGCCTTAGTGGGTAAAATAGAAGAAACTGAAAGCTAA |
| Sequence | MTLDLLEQLESKIQNTVDTIALLQMEVEELKEDKQVLTEKGEQLQAENIRLTEEHQKWQSRLSALVGKIEETES |
| Source of smORF | Swiss-Prot |
| Function | Non-essential, abundant cell division factor that is required for proper Z-ring formation. It is recruited early to the divisome by direct interaction with FtsZ, stimulating Z-ring assembly and thereby promoting cell division earlier in the cell cycle. Its recruitment to the Z-ring requires functional FtsA or ZipA. {ECO:0000255|HAMAP-Rule:MF_01196}. |
| Pubmed ID | |
| Domain | CDD:416309 |
| Functional Category | Others |
| Uniprot ID | A1SZR9 |
| ORF Length (Amino Acid) | 74 |
++ More..
| Conservation Analysis |
No. of Species: 34
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4068888 | 4069112 | - | NC_008709.1 | Psychromonas ingrahamii 37 |
| 2 | 2084752 | 2084994 | + | NZ_CP046793.1 | Vibrio metschnikovii |
| 3 | 228707 | 228949 | + | NZ_CP040021.1 | Salinivibrio kushneri |
| 4 | 1707987 | 1708229 | + | NZ_CP065150.1 | Vibrio kanaloae |
| 5 | 3059481 | 3059723 | - | NC_011753.2 | Vibrio atlanticus |
| 6 | 232572 | 232814 | + | NZ_CP039700.1 | Vibrio cyclitrophicus |
| 7 | 194723 | 194965 | + | NZ_CP071325.1 | Photobacterium ganghwense |
| 8 | 536683 | 536925 | + | NZ_CP005974.1 | Photobacterium gaetbulicola Gung47 |
| 9 | 3211850 | 3212092 | - | NZ_AP014635.1 | Vibrio tritonius |
| 10 | 1054779 | 1055021 | - | NZ_CP014056.2 | Grimontia hollisae |
| 11 | 266437 | 266679 | + | NZ_CP030788.1 | Vibrio campbellii |
| 12 | 3002200 | 3002442 | - | NZ_LT960611.1 | Vibrio tapetis subsp. tapetis |
| 13 | 473695 | 473937 | + | NZ_CP009467.1 | Vibrio harveyi |
| 14 | 2633862 | 2634104 | - | NZ_CP009977.1 | Vibrio natriegens NBRC 15636 = ATCC 14048 = DSM 759 |
| 15 | 1558072 | 1558314 | - | NZ_CP019959.1 | Vibrio owensii |
| 16 | 1379 | 1597 | - | NZ_CP018804.1 | Histophilus somni |
| 17 | 3963064 | 3963273 | + | NZ_CP040449.1 | Aeromonas simiae |
| 18 | 2374586 | 2374828 | - | NZ_CP035688.1 | Vibrio metoecus |
| 19 | 2715412 | 2715654 | - | NZ_AP014524.1 | Vibrio cholerae MS6 |
| 20 | 228834 | 229076 | + | NZ_AP018685.1 | Vibrio rumoiensis |
| 21 | 199683 | 199892 | + | NZ_CP012621.1 | Zobellella denitrificans |
| 22 | 4245735 | 4245944 | - | NZ_LR134376.1 | Aeromonas encheleia |
| 23 | 2188554 | 2188772 | - | NC_006300.1 | [Mannheimia] succiniciproducens MBEL55E |
| 24 | 3386554 | 3386763 | + | NZ_CP044060.1 | Aeromonas veronii |
| 25 | 1780502 | 1780720 | - | NZ_CP015031.1 | Basfia succiniciproducens |
| 26 | 4592848 | 4593057 | - | NZ_AP022188.1 | Aeromonas media |
| 27 | 3634937 | 3635146 | + | NZ_CP065745.1 | Aeromonas allosaccharophila |
| 28 | 202166 | 202375 | + | NZ_CP050851.1 | Aeromonas hydrophila |
| 29 | 3693357 | 3693566 | + | NZ_CP051883.1 | Aeromonas salmonicida |
| 30 | 1937455 | 1937673 | + | NZ_LT906448.1 | Pasteurella dagmatis |
| 31 | 138931 | 139173 | - | NC_013456.1 | Vibrio antiquarius |
| 32 | 3009929 | 3010171 | - | NZ_CP031781.1 | Vibrio parahaemolyticus |
| 33 | 359417 | 359635 | - | NZ_LR134167.1 | Avibacterium volantium |
| 34 | 53187 | 53405 | - | NZ_CP016605.1 | Bisgaardia hudsonensis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP046793.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03320.15 | 0.71 | 24 | 321.0 | opposite-strand | Bacterial fructose-1,6-bisphosphatase, glpX-encoded |
++ More..