Result : C1P621
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Uncharacterized protein YjeV |
| NCBI Accession ID | U00096.3 |
| Organism | Escherichia coli (strain K12) |
| Left | 4392892 |
| Right | 4392945 |
| Strand | + |
| Nucleotide Sequence | ATGCGTTTTTATTTTTATTCACAAGCTGTGGATGAATCAGGCGTCACGCGGTAA |
| Sequence | MRFYFYSQAVDESGVTR |
| Source of smORF | Swiss-Prot |
| Function | |
| Pubmed ID | 9278503 16738553 19121005 |
| Domain | |
| Functional Category | Others |
| Uniprot ID | C1P621 |
| ORF Length (Amino Acid) | 17 |
++ More..
| Conservation Analysis |
No. of Species: 7
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 5246744 | 5246797 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 4392892 | 4392945 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 4497710 | 4497763 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 3844455 | 3844508 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 3313361 | 3313414 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 6 | 5537091 | 5537144 | - | NZ_CP060111.1 | Klebsiella michiganensis |
| 7 | 5124506 | 5124559 | - | NZ_CP046672.1 | Raoultella ornithinolytica |
| 8 | 5542703 | 5542756 | - | NZ_CP036175.1 | Klebsiella huaxiensis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF12794.9 | 0.86 | 6 | 3754 | opposite-strand | Mechanosensitive ion channel inner membrane domain 1 |
| 2 | PF00924.20 | 0.86 | 6 | 3754 | opposite-strand | Mechanosensitive ion channel |
| 3 | PF12795.9 | 0.86 | 6 | 3754 | opposite-strand | Mechanosensitive ion channel porin domain |
| 4 | PF02666.17 | 0.86 | 6 | 2764 | opposite-strand | Phosphatidylserine decarboxylase |
| 5 | PF03193.18 | 0.86 | 6 | 1615 | opposite-strand | RsgA GTPase |
| 6 | PF00929.26 | 0.86 | 6 | 975 | same-strand | Exonuclease |
| 7 | PF08331.12 | 1.0 | 7 | -17.0 | opposite-strand | Domain of unknown function (DUF1730) |
| 8 | PF13484.8 | 1.0 | 7 | -17.0 | opposite-strand | 4Fe-4S double cluster binding domain |
| 9 | PF01256.19 | 1.0 | 7 | 1130.0 | same-strand | Carbohydrate kinase |
| 10 | PF03853.17 | 1.0 | 7 | 1130.0 | same-strand | YjeF-related protein N-terminus |
| 11 | PF02367.19 | 1.0 | 7 | 2640.0 | same-strand | Threonylcarbamoyl adenosine biosynthesis protein TsaE |
| 12 | PF01520.20 | 1.0 | 7 | 3120.0 | same-strand | N-acetylmuramoyl-L-alanine amidase |
| 13 | PF01119.21 | 1.0 | 7 | 4467.0 | same-strand | DNA mismatch repair protein, C-terminal domain |
| 14 | PF08676.13 | 1.0 | 7 | 4467.0 | same-strand | MutL C terminal dimerisation domain |
++ More..