Protein Information |
Information Type | Description |
---|---|
Protein name | Uncharacterized protein IlvX |
NCBI Accession ID | U00096.3 |
Organism | Escherichia coli (strain K12) |
Left | 3950507 |
Right | 3950557 |
Strand | + |
Nucleotide Sequence | ATGAATAACAGCACAAAATTCTGTTTCTCAAGATTCAGGACGGGGAACTAA |
Sequence | MNNSTKFCFSRFRTGN |
Source of smORF | Swiss-Prot |
Function | |
Pubmed ID | 9278503 16738553 19121005 19734316 |
Domain | |
Functional Category | Others |
Uniprot ID | C1P619 |
ORF Length (Amino Acid) | 16 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 3917627 | 3917677 | + | NZ_AP014857.1 | Escherichia albertii |
2 | 3950507 | 3950557 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
3 | 2823686 | 2823736 | - | NZ_CP057657.1 | Escherichia fergusonii |
4 | 4279502 | 4279552 | + | NZ_CP061527.1 | Shigella dysenteriae |
5 | 4393753 | 4393803 | - | NZ_LR134340.1 | Escherichia marmotae |
6 | 3959947 | 3959997 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
7 | 4744077 | 4744127 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
8 | 1914426 | 1914476 | + | NZ_CP053416.1 | Salmonella bongori |
9 | 4678418 | 4678468 | - | NZ_CP009756.1 | Enterobacter cloacae |
10 | 4558796 | 4558846 | - | NZ_CP027986.1 | Enterobacter sichuanensis |
11 | 11544 | 11594 | + | NZ_CP017280.1 | Enterobacter ludwigii |
12 | 512441 | 512491 | + | NZ_CP045205.1 | Citrobacter telavivensis |
13 | 3292637 | 3292687 | + | NZ_CP016337.1 | Kosakonia sacchari |
14 | 4912823 | 4912873 | - | NZ_CP043318.1 | Enterobacter chengduensis |
15 | 2757287 | 2757337 | + | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
16 | 4616873 | 4616923 | - | NC_015968.1 | Enterobacter soli |
17 | 4559178 | 4559228 | - | NZ_CP017184.1 | Enterobacter roggenkampii |
18 | 4459485 | 4459535 | - | NZ_AP022508.1 | Enterobacter bugandensis |
19 | 2622767 | 2622817 | + | NZ_AP019007.1 | Enterobacter oligotrophicus |
20 | 3758632 | 3758682 | + | NZ_CP045769.1 | Enterobacter cancerogenus |
21 | 1160290 | 1160340 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
22 | 4108933 | 4108983 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
23 | 288600 | 288650 | - | NZ_CP051548.1 | Phytobacter diazotrophicus |
24 | 4409404 | 4409454 | - | NZ_CP011602.1 | Phytobacter ursingii |
25 | 172569 | 172619 | + | NZ_CP013990.1 | Leclercia adecarboxylata |
26 | 139495 | 139545 | + | NZ_CP063425.1 | Kosakonia pseudosacchari |
27 | 4208075 | 4208125 | - | NC_013716.1 | Citrobacter rodentium ICC168 |
28 | 5414887 | 5414937 | - | NZ_CP046672.1 | Raoultella ornithinolytica |
29 | 2996878 | 2996928 | - | NZ_CP045300.1 | Kosakonia arachidis |
30 | 102493 | 102543 | + | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
31 | 5372322 | 5372372 | - | NZ_CP054254.1 | Klebsiella variicola |
32 | 129441 | 129491 | + | NC_016845.1 | Klebsiella pneumoniae subsp. pneumoniae HS11286 |
33 | 5080044 | 5080094 | - | NZ_CP065838.1 | Klebsiella quasipneumoniae |
34 | 4526389 | 4526439 | - | NZ_CP035129.1 | Kosakonia cowanii |
35 | 5483277 | 5483327 | + | NZ_CP015113.1 | Kosakonia radicincitans |
36 | 5243626 | 5243676 | - | NZ_CP014007.2 | Kosakonia oryzae |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00126.29 | 0.97 | 34 | 2538 | opposite-strand | Bacterial regulatory helix-turn-helix protein, lysR family |
2 | PF03466.22 | 0.94 | 33 | 2537.5 | opposite-strand | LysR substrate binding domain |
3 | PF04219.14 | 0.97 | 34 | 2081 | same-strand | Protein of unknown function, DUF |
4 | PF01078.23 | 1.0 | 35 | 529.0 | opposite-strand | Magnesium chelatase, subunit ChlI |
5 | PF13541.8 | 0.97 | 34 | 529 | opposite-strand | Subunit ChlI of Mg-chelatase |
6 | PF13335.8 | 1.0 | 35 | 529.0 | opposite-strand | Magnesium chelatase, subunit ChlI C-terminal |
7 | PF07728.16 | 1.0 | 35 | 529.0 | opposite-strand | AAA domain (dynein-related subfamily) |
8 | PF02776.20 | 1.0 | 35 | 3.0 | same-strand | Thiamine pyrophosphate enzyme, N-terminal TPP binding domain |
9 | PF02775.23 | 1.0 | 35 | 3.0 | same-strand | Thiamine pyrophosphate enzyme, C-terminal TPP binding domain |
10 | PF00205.24 | 1.0 | 35 | 3.0 | same-strand | Thiamine pyrophosphate enzyme, central domain |
11 | PF13710.8 | 1.0 | 35 | 1646.0 | same-strand | ACT domain |
12 | PF13291.8 | 0.94 | 33 | 1646.0 | same-strand | ACT domain |
13 | PF01063.21 | 1.0 | 35 | 1928.0 | same-strand | Amino-transferase class IV |
14 | PF00920.23 | 1.0 | 35 | 2921.5 | same-strand | Dehydratase family |
15 | PF00291.27 | 1.0 | 35 | 4772 | same-strand | Pyridoxal-phosphate dependent enzyme |
16 | PF00585.20 | 1.0 | 35 | 4772 | same-strand | C-terminal regulatory domain of Threonine dehydratase |