Result : C1P616

Protein Information

• Protein name: Small toxic protein IbsD
• NCBI Accession ID: U00096.3
• Organism: Escherichia coli (strain K12)
• Left: 3194766
• Right: 3194825
• Strand: +
• Nucleotide Sequence: ATGATGAAGCTCGTCATCATACTGATTGTGTTGTTACTCGTAAGTTTCGCAGCTTATTAA
• Sequence: MMKLVIILIVLLLVSFAAY
• Source of smORF: Swiss-Prot
• Function: Toxic component of a type I toxin-antitoxin (TA) system.
• Pubmed ID: 9278503 16738553 18710431
• Functional Category: Toxin_type_1
• Uniprot ID: C1P616
• ORF Length (Amino Acid): 19

Conservation Analysis

No. of Species: 3

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	5417675	5417734	-	NZ_CP011602.1	Phytobacter ursingii
2	2309265	2309324	-	NC_013716.1	Citrobacter rodentium ICC168
3	215387	215446	-	NZ_CP053416.1	Salmonella bongori

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_013716.1

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF00692.21	0.67	2	6454.0	same-strand	dUTPase
2	PF00485.20	0.67	2	5652.5	same-strand	Phosphoribulokinase / Uridine kinase family
3	PF13238.8	0.67	2	5652.5	same-strand	AAA domain
4	PF00990.23	0.67	2	2423.5	opposite-strand	Diguanylate cyclase, GGDEF domain
5	PF05231.16	0.67	2	2423.5	opposite-strand	MASE1
6	PF00563.22	0.67	2	2423.5	opposite-strand	EAL domain
7	PF00989.27	0.67	2	2423.5	opposite-strand	PAS fold
8	PF08448.12	0.67	2	2423.5	opposite-strand	PAS fold
9	PF13426.9	0.67	2	2423.5	opposite-strand	PAS domain
10	PF08447.14	0.67	2	2423.5	opposite-strand	PAS fold
11	PF06029.13	0.67	2	1586.5	same-strand	AlkA N-terminal domain
12	PF13533.8	0.67	2	262.0	opposite-strand	Biotin-lipoyl like
13	PF13437.8	0.67	2	262.0	opposite-strand	HlyD family secretion protein
14	PF16576.7	0.67	2	262.0	opposite-strand	Barrel-sandwich domain of CusB or HlyD membrane-fusion
15	PF00873.21	0.67	2	3081.0	opposite-strand	AcrB/AcrD/AcrF family
16	PF07690.18	0.67	2	7719.5	opposite-strand	Major Facilitator Superfamily
17	PF02518.28	0.67	2	9131.5	opposite-strand	Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase
18	PF00672.27	0.67	2	9131.5	opposite-strand	HAMP domain
19	PF00512.27	0.67	2	9131.5	opposite-strand	His Kinase A (phospho-acceptor) domain