Result : C1P611
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Small toxic protein ShoB |
| NCBI Accession ID | U00096.3 |
| Organism | Escherichia coli (strain K12) |
| Left | 2700117 |
| Right | 2700197 |
| Strand | - |
| Nucleotide Sequence | ATGACTGATTGCCGATACCTGATTAAACGGGTCATCAAAATCATCATTGCTGTTTTACAGCTGATCCTTCTGTTCTTATAA |
| Sequence | MTDCRYLIKRVIKIIIAVLQLILLFL |
| Source of smORF | Swiss-Prot |
| Function | Toxic component of a type I toxin-antitoxin (TA) system. May be a toxic protein; overexpression causes cessation of growth and rapid membrane depolarization. Overexpression induces stress-response and a number of membrane protein genes. {ECO:0000269|Pubmed:18710431}. |
| Pubmed ID | 9278503 16738553 18710431 |
| Domain | |
| Functional Category | Toxin_type_1 |
| Uniprot ID | C1P611 |
| ORF Length (Amino Acid) | 26 |
++ More..
| Conservation Analysis |
No. of Species: 7
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3420635 | 3420715 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 2700117 | 2700197 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 2697332 | 2697412 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 4071565 | 4071645 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 5 | 1015184 | 1015264 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 6 | 2658598 | 2658678 | - | NZ_AP014857.1 | Escherichia albertii |
| 7 | 1495826 | 1495906 | + | NZ_CP035129.1 | Kosakonia cowanii |
| 8 | 3220682 | 3220756 | - | NZ_LR134340.1 | Escherichia marmotae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF12797.9 | 0.86 | 6 | 194 | opposite-strand | 4Fe-4S binding domain |
| 2 | PF01648.22 | 0.86 | 6 | 421 | same-strand | 4'-phosphopantetheinyl transferase superfamily |
| 3 | PF03740.15 | 0.71 | 5 | 800.5 | same-strand | Pyridoxal phosphate biosynthesis protein PdxJ |
| 4 | PF02565.17 | 0.71 | 5 | 1543.5 | same-strand | Recombination protein O C terminal |
| 5 | PF11967.10 | 0.71 | 5 | 1543.5 | same-strand | Recombination protein O N terminal |
| 6 | PF01926.25 | 0.71 | 5 | 2284.5 | same-strand | 50S ribosome-binding GTPase |
| 7 | PF07650.19 | 0.71 | 5 | 2284.5 | same-strand | KH domain |
| 8 | PF02421.20 | 0.71 | 5 | 2284.5 | same-strand | Ferrous iron transport protein B |
| 9 | PF00009.29 | 0.71 | 5 | 2284.5 | same-strand | Elongation factor Tu GTP binding domain |
| 10 | PF10662.11 | 0.71 | 5 | 2284.5 | same-strand | Ethanolamine utilisation - propanediol utilisation |
| 11 | PF13401.8 | 0.71 | 5 | 2284.5 | same-strand | AAA domain |
++ More..