ProsmORF-pred
Result : C1P609
Protein Information
Information Type Description
Protein name Uncharacterized membrane protein YohP
NCBI Accession ID U00096.3
Organism Escherichia coli (strain K12)
Left 2228982
Right 2229065
Strand +
Nucleotide Sequence ATGAAAATTATACTCTGGGCTGTATTGATTATTTTCCTGATTGGGCTACTGGTGGTGACTGGCGTATTTAAGATGATATTTTAA
Sequence MKIILWAVLIIFLIGLLVVTGVFKMIF
Source of smORF Swiss-Prot
Function
Pubmed ID 9278503 16738553 19121005 19734316 21778229
Domain
Functional Category Others
Uniprot ID C1P609
ORF Length (Amino Acid) 27
++ More..
Conservation Analysis
Conservation Analysis
No. of Species: 49
Sr.No. Left Position Right Position Strand NCBI Accession id Species Name
1 2850166 2850249 + NZ_CP012257.1 Cronobacter universalis NCTC 9529
2 2958031 2958114 + NC_002695.2 Escherichia coli O157:H7 str. Sakai
3 2228982 2229065 + NC_000913.3 Escherichia coli str. K-12 substr. MG1655
4 2251806 2251889 + NC_004337.2 Shigella flexneri 2a str. 301
5 3215959 3216042 + NZ_LR134201.1 Cedecea lapagei
6 2775889 2775972 + NZ_LR134340.1 Escherichia marmotae
7 2947661 2947744 + NZ_CP012266.1 Cronobacter dublinensis subsp. dublinensis LMG 23823
8 1654126 1654209 + NZ_CP061527.1 Shigella dysenteriae
9 2823810 2823893 + NZ_CP012264.1 Cronobacter condimenti 1330
10 1299526 1299609 - NZ_CP013940.1 Cronobacter malonaticus LMG 23826
11 578727 578810 - NZ_CP027107.1 Cronobacter sakazakii
12 3443478 3443561 + NZ_CP023525.1 Cedecea neteri
13 3224185 3224268 - NZ_CP042941.1 Atlantibacter hermannii
14 1103094 1103177 - NZ_CP012268.1 Cronobacter muytjensii ATCC 51329
15 1226405 1226488 + NZ_CP057657.1 Escherichia fergusonii
16 2868616 2868708 + NZ_AP014936.1 Sulfurifustis variabilis
17 1356349 1356432 - NZ_CP048784.1 Serratia liquefaciens
18 1365759 1365842 - NZ_CP050150.1 Hafnia alvei
19 1210976 1211059 + NZ_CP023567.1 Erwinia pyrifoliae
20 1417142 1417225 - NZ_CP038662.1 Serratia nematodiphila
21 721930 722013 - NZ_CP016948.1 Serratia surfactantfaciens
22 3643277 3643360 + NZ_CP071320.1 Serratia ureilytica
23 1154786 1154869 + NZ_LN907827.1 Erwinia gerundensis
24 3622142 3622225 - NZ_CP011254.1 Serratia fonticola
25 2668988 2669071 - NC_010694.1 Erwinia tasmaniensis Et1/99
26 4116031 4116114 - NZ_CP006569.1 Sodalis praecaptivus
27 2520746 2520829 + NZ_CP022987.1 Pusillimonas thiosulfatoxidans
28 3070745 3070828 + NZ_AP023184.1 Buttiauxella agrestis
29 3191340 3191423 + NZ_CP063425.1 Kosakonia pseudosacchari
30 4767441 4767524 - NZ_CP016337.1 Kosakonia sacchari
31 2270581 2270664 + NC_003197.2 Salmonella enterica subsp. enterica serovar Typhimurium str. LT2
32 307746 307829 - NZ_CP038469.1 Citrobacter tructae
33 264247 264330 + NZ_CP053416.1 Salmonella bongori
34 2362790 2362873 - NZ_CP030265.1 Skermanella pratensis
35 1643994 1644077 - NZ_CP035129.1 Kosakonia cowanii
36 2404197 2404280 + NZ_CP017279.1 Enterobacter ludwigii
37 2376299 2376382 + NC_013716.1 Citrobacter rodentium ICC168
38 938268 938351 + NZ_CP033744.1 Citrobacter freundii
39 4123376 4123459 - NZ_CP044098.1 Citrobacter portucalensis
40 362845 362928 - NZ_CP045769.1 Enterobacter cancerogenus
41 896556 896639 + NZ_AP019007.1 Enterobacter oligotrophicus
42 1914580 1914663 + NZ_CP023529.1 Lelliottia amnigena
43 3265775 3265858 + NZ_CP009756.1 Enterobacter cloacae
44 2480545 2480631 - NZ_CP041636.1 Ferrovibrio terrae
45 3372899 3372982 + NZ_CP015113.1 Kosakonia radicincitans
46 1805128 1805211 - NZ_CP014007.2 Kosakonia oryzae
47 4828659 4828742 - NZ_CP045300.1 Kosakonia arachidis
48 2800975 2801058 + NZ_CP009533.1 Pseudomonas rhizosphaerae
49 900668 900751 - NZ_CP011602.1 Phytobacter ursingii
50 2238865 2238948 - NZ_CP051548.1 Phytobacter diazotrophicus
++ More..
Neighborhood Conservation Analysis
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Conservation Analysis
Neighborhood Representative Chosen(Species): NZ_CP012257.1
Sr.No. Domain Co-occurrence Frequency No. of species in which domain occurs with smORF Median distance b/w smORF and domain bearing ORFs Orientation relative to smORF PFAM Information
1 PF00768.22 0.61 30 2541 opposite-strand D-alanyl-D-alanine carboxypeptidase
2 PF04893.19 0.63 31 2133.5 opposite-strand Yip1 domain
3 PF09335.13 0.65 32 1690 same-strand SNARE associated Golgi protein
++ More..