Result : C1P606
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Uncharacterized protein YoeI |
| NCBI Accession ID | U00096.3 |
| Organism | Escherichia coli (strain K12) |
| Left | 2087052 |
| Right | 2087114 |
| Strand | - |
| Nucleotide Sequence | ATGGGGCAATTTTTTGCTTACGCGACGGTTATCACCGTAAAGGAGAATGACCATGTCGCATAA |
| Sequence | MGQFFAYATVITVKENDHVA |
| Source of smORF | Swiss-Prot |
| Function | The ORF matches to the profile of NF033439. Profile Description: membrane protein YoeI. YoeI, a hydrophobic protein of only 20 amino acids, is found in at least these genera: Escherichia, Salmonella, Citrobacter, Enterobacter, and Klebsiella. It is known to be expressed in E. coli. |
| Pubmed ID | 9278503 16738553 19121005 19734316 |
| Domain | CDD:380281 |
| Functional Category | Others |
| Uniprot ID | C1P606 |
| ORF Length (Amino Acid) | 20 |
++ More..
| Conservation Analysis |
No. of Species: 56
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2759695 | 2759757 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 2063149 | 2063211 | - | NZ_AP014857.1 | Escherichia albertii |
| 3 | 2087052 | 2087114 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 4 | 1074605 | 1074667 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 5 | 2092621 | 2092683 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 6 | 2638895 | 2638957 | - | NZ_LR134340.1 | Escherichia marmotae |
| 7 | 1568810 | 1568872 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 8 | 2147172 | 2147234 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 9 | 2934288 | 2934350 | - | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 10 | 152601 | 152663 | - | NZ_CP053416.1 | Salmonella bongori |
| 11 | 457371 | 457433 | + | NZ_CP038469.1 | Citrobacter tructae |
| 12 | 2721009 | 2721071 | - | NZ_CP012264.1 | Cronobacter condimenti 1330 |
| 13 | 1582368 | 1582430 | + | NZ_CP054058.1 | Scandinavium goeteborgense |
| 14 | 2274133 | 2274195 | - | NZ_CP017279.1 | Enterobacter ludwigii |
| 15 | 3134161 | 3134223 | - | NZ_CP009756.1 | Enterobacter cloacae |
| 16 | 2981031 | 2981093 | - | NZ_CP017184.1 | Enterobacter roggenkampii |
| 17 | 3027299 | 3027361 | - | NZ_CP027986.1 | Enterobacter sichuanensis |
| 18 | 3007711 | 3007773 | - | NZ_AP022508.1 | Enterobacter bugandensis |
| 19 | 771638 | 771700 | - | NZ_AP019007.1 | Enterobacter oligotrophicus |
| 20 | 2497443 | 2497505 | + | NZ_CP045205.1 | Citrobacter telavivensis |
| 21 | 4435806 | 4435868 | - | NZ_CP020388.1 | Pluralibacter gergoviae |
| 22 | 2250376 | 2250438 | - | NC_013716.1 | Citrobacter rodentium ICC168 |
| 23 | 4347551 | 4347613 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
| 24 | 744927 | 744989 | + | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 25 | 3301110 | 3301172 | - | NZ_CP043318.1 | Enterobacter chengduensis |
| 26 | 2843368 | 2843430 | - | NZ_CP012266.1 | Cronobacter dublinensis subsp. dublinensis LMG 23823 |
| 27 | 1215869 | 1215931 | + | NZ_CP012268.1 | Cronobacter muytjensii ATCC 51329 |
| 28 | 2743699 | 2743761 | - | NZ_CP012257.1 | Cronobacter universalis NCTC 9529 |
| 29 | 1415773 | 1415835 | + | NZ_CP013940.1 | Cronobacter malonaticus LMG 23826 |
| 30 | 2964671 | 2964733 | - | NC_015968.1 | Enterobacter soli |
| 31 | 1708075 | 1708137 | + | NZ_CP013990.1 | Leclercia adecarboxylata |
| 32 | 4260514 | 4260576 | + | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
| 33 | 801046 | 801108 | - | NZ_CP033744.1 | Citrobacter freundii |
| 34 | 4299840 | 4299902 | + | NZ_CP044098.1 | Citrobacter portucalensis |
| 35 | 1984478 | 1984540 | + | NZ_CP060111.1 | Klebsiella michiganensis |
| 36 | 1768762 | 1768824 | + | NZ_CP054254.1 | Klebsiella variicola |
| 37 | 3534460 | 3534522 | - | NC_016845.1 | Klebsiella pneumoniae subsp. pneumoniae HS11286 |
| 38 | 1718242 | 1718304 | + | NZ_CP065838.1 | Klebsiella quasipneumoniae |
| 39 | 3055015 | 3055077 | - | NZ_CP063425.1 | Kosakonia pseudosacchari |
| 40 | 12798 | 12860 | + | NZ_CP016337.1 | Kosakonia sacchari |
| 41 | 1755558 | 1755620 | - | NZ_CP023529.1 | Lelliottia amnigena |
| 42 | 497853 | 497915 | + | NZ_CP045769.1 | Enterobacter cancerogenus |
| 43 | 1652747 | 1652809 | + | NZ_AP023184.1 | Buttiauxella agrestis |
| 44 | 1841268 | 1841333 | + | NZ_CP050508.1 | Raoultella terrigena |
| 45 | 1569034 | 1569096 | + | NZ_LR134201.1 | Cedecea lapagei |
| 46 | 4956112 | 4956174 | + | NZ_CP045300.1 | Kosakonia arachidis |
| 47 | 3239293 | 3239355 | - | NZ_CP015113.1 | Kosakonia radicincitans |
| 48 | 1941558 | 1941620 | + | NZ_CP014007.2 | Kosakonia oryzae |
| 49 | 2094804 | 2094866 | + | NZ_CP036175.1 | Klebsiella huaxiensis |
| 50 | 1781773 | 1781835 | + | NZ_CP041247.1 | Raoultella electrica |
| 51 | 1688895 | 1688957 | + | NZ_LR134475.1 | Klebsiella aerogenes |
| 52 | 1631885 | 1631947 | + | NZ_CP023525.1 | Cedecea neteri |
| 53 | 1783325 | 1783390 | + | NZ_CP046672.1 | Raoultella ornithinolytica |
| 54 | 5408260 | 5408325 | - | NZ_CP026047.1 | Raoultella planticola |
| 55 | 1007830 | 1007892 | + | NZ_CP011602.1 | Phytobacter ursingii |
| 56 | 2356633 | 2356695 | + | NZ_CP051548.1 | Phytobacter diazotrophicus |
| 57 | 1683225 | 1683287 | + | NZ_CP045845.1 | Kluyvera intermedia |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00768.22 | 0.75 | 42 | 3210 | same-strand | D-alanyl-D-alanine carboxypeptidase |
| 2 | PF07943.15 | 0.75 | 42 | 3210 | same-strand | Penicillin-binding protein 5, C-terminal domain |
| 3 | PF13354.8 | 0.68 | 38 | 3210 | same-strand | Beta-lactamase enzyme family |
| 4 | PF08411.12 | 0.93 | 52 | 1484 | opposite-strand | Exonuclease C-terminal |
| 5 | PF00929.26 | 0.93 | 52 | 1484 | opposite-strand | Exonuclease |
| 6 | PF13520.8 | 1.0 | 56 | -10 | same-strand | Amino acid permease |
| 7 | PF00324.23 | 0.89 | 50 | -10 | same-strand | Amino acid permease |
| 8 | PF03466.22 | 0.75 | 42 | 220 | same-strand | LysR substrate binding domain |
| 9 | PF00126.29 | 0.77 | 43 | 220.5 | same-strand | Bacterial regulatory helix-turn-helix protein, lysR family |
| 10 | PF01370.23 | 0.91 | 51 | 1189.5 | same-strand | NAD dependent epimerase/dehydratase family |
| 11 | PF01634.20 | 0.98 | 55 | 2381.0 | opposite-strand | ATP phosphoribosyltransferase |
| 12 | PF08029.13 | 0.98 | 55 | 2383.0 | opposite-strand | HisG, C-terminal domain |
| 13 | PF00815.22 | 0.95 | 53 | 3300 | opposite-strand | Histidinol dehydrogenase |
| 14 | PF00155.23 | 0.82 | 46 | 4593.0 | opposite-strand | Aminotransferase class I and II |
++ More..