Result : C1P604
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Uncharacterized protein YobI |
| NCBI Accession ID | U00096.3 |
| Organism | Escherichia coli (strain K12) |
| Left | 1946115 |
| Right | 1946180 |
| Strand | - |
| Nucleotide Sequence | ATGTATATTTTTATTACGCATTTCTTCACTGAATATGTAATATTAAAATATTTGCTTCCAATATAA |
| Sequence | MYIFITHFFTEYVILKYLLPI |
| Source of smORF | Swiss-Prot |
| Function | |
| Pubmed ID | 9278503 16738553 19121005 19734316 |
| Domain | |
| Functional Category | Others |
| Uniprot ID | C1P604 |
| ORF Length (Amino Acid) | 21 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2548182 | 2548247 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 1946115 | 1946180 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 2517763 | 2517828 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 4 | 1909987 | 1910052 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01297.19 | 1.0 | 3 | 3497.5 | same-strand | Zinc-uptake complex component A periplasmic |
| 2 | PF00005.29 | 1.0 | 3 | 2698.0 | opposite-strand | ABC transporter |
| 3 | PF00950.19 | 1.0 | 3 | 1916.0 | opposite-strand | ABC 3 transport family |
| 4 | PF05496.14 | 1.0 | 3 | 759.0 | same-strand | Holliday junction DNA helicase RuvB P-loop domain |
| 5 | PF17864.3 | 1.0 | 3 | 759.0 | same-strand | RuvB AAA lid domain |
| 6 | PF05491.15 | 1.0 | 3 | 759.0 | same-strand | RuvB C-terminal winged helix domain |
| 7 | PF00004.31 | 1.0 | 3 | 759.0 | same-strand | ATPase family associated with various cellular activities (AAA) |
| 8 | PF01330.23 | 1.0 | 3 | 139.0 | same-strand | RuvA N terminal domain |
| 9 | PF14520.8 | 1.0 | 3 | 139.0 | same-strand | Helix-hairpin-helix domain |
| 10 | PF07499.15 | 1.0 | 3 | 139.0 | same-strand | RuvA, C-terminal domain |
| 11 | PF05708.14 | 1.0 | 3 | 71.0 | opposite-strand | Permuted papain-like amidase enzyme, YaeF/YiiX, C92 family |
| 12 | PF02075.19 | 1.0 | 3 | 675.0 | same-strand | Crossover junction endodeoxyribonuclease RuvC |
| 13 | PF01709.22 | 0.67 | 2 | 1231 | same-strand | Transcriptional regulator |
| 14 | PF00293.30 | 0.67 | 2 | 2000 | same-strand | NUDIX domain |
| 15 | PF00152.22 | 0.67 | 2 | 2570 | same-strand | tRNA synthetases class II (D, K and N) |
| 16 | PF02938.16 | 0.67 | 2 | 2570 | same-strand | GAD domain |
| 17 | PF01336.27 | 0.67 | 2 | 2570 | same-strand | OB-fold nucleic acid binding domain |
++ More..