ProsmORF-pred
Result : C1P604
Protein Information
Information Type Description
Protein name Uncharacterized protein YobI
NCBI Accession ID U00096.3
Organism Escherichia coli (strain K12)
Left 1946115
Right 1946180
Strand -
Nucleotide Sequence ATGTATATTTTTATTACGCATTTCTTCACTGAATATGTAATATTAAAATATTTGCTTCCAATATAA
Sequence MYIFITHFFTEYVILKYLLPI
Source of smORF Swiss-Prot
Function
Pubmed ID 9278503 16738553 19121005 19734316
Domain
Functional Category Others
Uniprot ID C1P604
ORF Length (Amino Acid) 21
++ More..
Conservation Analysis
Conservation Analysis
No. of Species: 3
Sr.No. Left Position Right Position Strand NCBI Accession id Species Name
1 2548182 2548247 - NC_002695.2 Escherichia coli O157:H7 str. Sakai
2 1946115 1946180 - NC_000913.3 Escherichia coli str. K-12 substr. MG1655
3 2517763 2517828 - NZ_CP061527.1 Shigella dysenteriae
4 1909987 1910052 - NC_004337.2 Shigella flexneri 2a str. 301
++ More..
Neighborhood Conservation Analysis
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Conservation Analysis
Neighborhood Representative Chosen(Species): NC_002695.2
Sr.No. Domain Co-occurrence Frequency No. of species in which domain occurs with smORF Median distance b/w smORF and domain bearing ORFs Orientation relative to smORF PFAM Information
1 PF01297.19 1.0 3 3497.5 same-strand Zinc-uptake complex component A periplasmic
2 PF00005.29 1.0 3 2698.0 opposite-strand ABC transporter
3 PF00950.19 1.0 3 1916.0 opposite-strand ABC 3 transport family
4 PF05496.14 1.0 3 759.0 same-strand Holliday junction DNA helicase RuvB P-loop domain
5 PF17864.3 1.0 3 759.0 same-strand RuvB AAA lid domain
6 PF05491.15 1.0 3 759.0 same-strand RuvB C-terminal winged helix domain
7 PF00004.31 1.0 3 759.0 same-strand ATPase family associated with various cellular activities (AAA)
8 PF01330.23 1.0 3 139.0 same-strand RuvA N terminal domain
9 PF14520.8 1.0 3 139.0 same-strand Helix-hairpin-helix domain
10 PF07499.15 1.0 3 139.0 same-strand RuvA, C-terminal domain
11 PF05708.14 1.0 3 71.0 opposite-strand Permuted papain-like amidase enzyme, YaeF/YiiX, C92 family
12 PF02075.19 1.0 3 675.0 same-strand Crossover junction endodeoxyribonuclease RuvC
13 PF01709.22 0.67 2 1231 same-strand Transcriptional regulator
14 PF00293.30 0.67 2 2000 same-strand NUDIX domain
15 PF00152.22 0.67 2 2570 same-strand tRNA synthetases class II (D, K and N)
16 PF02938.16 0.67 2 2570 same-strand GAD domain
17 PF01336.27 0.67 2 2570 same-strand OB-fold nucleic acid binding domain
++ More..