Result : C1F7F1
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | 30S ribosomal protein S20 |
| NCBI Accession ID | CP001472.1 |
| Organism | Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161) |
| Left | 2032886 |
| Right | 2033161 |
| Strand | + |
| Nucleotide Sequence | ATGGCGAACCATGTTTCTTCGCTCAAGCGCGCCCGTCAGACCGTACGCAAGACCGCAGTGAACCGTGCCAACAAGAGCCGCGTGCGTGGCTCGCTGCGCTCGCTGCGTGAGGCGATTCAGAAGGGCGACGTGAAGGCCGCTCAGGAGCAGTACAAGGCAACGGCTTCGGCGCTCGACAAGAGCGTGCAGAAGGGCATTCTGCATGCCAACACTGCCTCCCGCTACAAGAGCCGCCTGAATGCCCGCGTCAAGGCGCTGGCCACCCAAGCTGCCTAA |
| Sequence | MANHVSSLKRARQTVRKTAVNRANKSRVRGSLRSLREAIQKGDVKAAQEQYKATASALDKSVQKGILHANTASRYKSRLNARVKALATQAA |
| Source of smORF | Swiss-Prot |
| Function | Binds directly to 16S ribosomal RNA. {ECO:0000255|HAMAP-Rule:MF_00500}. |
| Pubmed ID | 19201974 |
| Domain | CDD:412349 |
| Functional Category | Ribosomal_protein |
| Uniprot ID | C1F7F1 |
| ORF Length (Amino Acid) | 91 |
++ More..
| Conservation Analysis |
No. of Species: 72
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2032886 | 2033161 | + | NC_012483.1 | Acidobacterium capsulatum ATCC 51196 |
| 2 | 2404850 | 2405125 | - | NZ_CP030840.1 | Acidisarcina polymorpha |
| 3 | 1051082 | 1051357 | + | NC_014963.1 | Terriglobus saanensis SP1PR4 |
| 4 | 4648909 | 4649184 | + | NC_016631.1 | Granulicella mallensis MP5ACTX8 |
| 5 | 1170126 | 1170401 | + | NC_018014.1 | Terriglobus roseus DSM 18391 |
| 6 | 3447463 | 3447744 | + | NC_015064.1 | Granulicella tundricola MP5ACTX9 |
| 7 | 6593178 | 6593459 | - | NZ_CP063849.1 | Paludibaculum fermentans |
| 8 | 4038817 | 4039080 | + | NZ_CP040818.1 | Paraoceanicella profunda |
| 9 | 3183682 | 3183948 | - | NZ_CP059896.1 | Ciceribacter thiooxidans |
| 10 | 1664987 | 1665250 | - | NZ_CP012023.1 | Celeribacter marinus |
| 11 | 3898708 | 3898974 | + | NZ_CP024899.1 | Rhodobaca barguzinensis |
| 12 | 981 | 1241 | - | NZ_CP029353.1 | Azospirillum thermophilum |
| 13 | 5892869 | 5893129 | + | NZ_CP042906.1 | Hypericibacter terrae |
| 14 | 4646837 | 4647103 | + | NZ_HG938353.1 | Neorhizobium galegae bv. orientalis str. HAMBI 540 |
| 15 | 4647969 | 4648235 | + | NC_015259.1 | Polymorphum gilvum SL003B-26A1 |
| 16 | 2353070 | 2353333 | + | NZ_CP025611.1 | Niveispirillum cyanobacteriorum |
| 17 | 1113377 | 1113652 | + | NZ_CP030918.1 | Paracoccus suum |
| 18 | 2805369 | 2805635 | + | NZ_CP053856.1 | Rhizobium pusense |
| 19 | 863454 | 863714 | + | NZ_CP012401.1 | Azospirillum thiophilum |
| 20 | 4039970 | 4040233 | + | NZ_CP065915.1 | Pelagovum pacificum |
| 21 | 1851665 | 1851934 | + | NZ_CP020612.1 | Paracoccus contaminans |
| 22 | 5868392 | 5868652 | + | NZ_CP030265.1 | Skermanella pratensis |
| 23 | 3307983 | 3308249 | + | NZ_CP021404.1 | Pacificitalea manganoxidans |
| 24 | 2655629 | 2655889 | + | NZ_CP029829.1 | Azospirillum ramasamyi |
| 25 | 2950235 | 2950501 | + | NZ_CP054836.1 | Oricola thermophila |
| 26 | 75769 | 76038 | + | NC_017379.1 | Helicobacter pylori Puno135 |
| 27 | 3857928 | 3858191 | + | NZ_CP034348.1 | Roseovarius faecimaris |
| 28 | 1318316 | 1318585 | - | NZ_CP045073.1 | Paracoccus kondratievae |
| 29 | 2256373 | 2256636 | + | NZ_CP042261.1 | Qingshengfaniella alkalisoli |
| 30 | 3965455 | 3965733 | - | NZ_CP054027.1 | Rhizobium hidalgonense |
| 31 | 4568162 | 4568440 | + | NZ_CP034998.1 | Rhizobium acidisoli |
| 32 | 456631 | 456900 | + | NZ_CP030239.1 | Paracoccus mutanolyticus |
| 33 | 91400 | 91660 | - | NZ_CP054619.1 | Azospirillum oryzae |
| 34 | 446751 | 447029 | + | NZ_CP071678.1 | Rhizobium ruizarguesonis |
| 35 | 2522263 | 2522526 | + | NZ_CP041636.1 | Ferrovibrio terrae |
| 36 | 2700952 | 2701215 | + | NZ_CP022196.1 | Celeribacter ethanolicus |
| 37 | 3543739 | 3544005 | + | NC_009952.1 | Dinoroseobacter shibae DFL 12 = DSM 16493 |
| 38 | 4528033 | 4528296 | + | NZ_CP004393.1 | Celeribacter indicus |
| 39 | 5863987 | 5864247 | + | NZ_CP042582.1 | Hypericibacter adhaerens |
| 40 | 4042916 | 4043182 | + | NZ_CP053562.1 | Thioclava electrotropha |
| 41 | 3910288 | 3910554 | + | NZ_CP019437.1 | Thioclava nitratireducens |
| 42 | 2050953 | 2051225 | - | NZ_CP020470.1 | Rhodobacter blasticus |
| 43 | 1040104 | 1040376 | + | NZ_AP018676.1 | Helicobacter cinaedi |
| 44 | 2290736 | 2291014 | - | NZ_CP054021.1 | Rhizobium indicum |
| 45 | 2429613 | 2429882 | - | NZ_CP012908.1 | Ketogulonicigenium vulgare |
| 46 | 1701706 | 1701978 | - | NC_004917.1 | Helicobacter hepaticus ATCC 51449 |
| 47 | 278366 | 278632 | + | NZ_LR723670.1 | Pseudorhizobium flavum |
| 48 | 4239208 | 4239474 | + | NZ_FO082820.1 | Pseudorhizobium banfieldiae |
| 49 | 4014116 | 4014388 | + | NC_014664.1 | Rhodomicrobium vannielii ATCC 17100 |
| 50 | 3287519 | 3287782 | + | NZ_CP003984.1 | Planktomarina temperata RCA23 |
| 51 | 618395 | 618664 | - | NC_022041.1 | Paracoccus aminophilus JCM 7686 |
| 52 | 2484185 | 2484448 | - | NZ_CP051181.1 | Thalassobius gelatinovorus |
| 53 | 310561 | 310827 | + | NZ_CP015421.1 | Rhodovulum sulfidophilum |
| 54 | 1292805 | 1293071 | - | NZ_CP004372.1 | Roseibacterium elongatum DSM 19469 |
| 55 | 2024031 | 2024294 | - | NZ_CP049037.1 | Pseudohalocynthiibacter aestuariivivens |
| 56 | 4350706 | 4350969 | + | NZ_CP034588.1 | Silicimonas algicola |
| 57 | 4144579 | 4144842 | + | NC_023135.1 | Leisingera methylohalidivorans DSM 14336 |
| 58 | 371368 | 371634 | + | NZ_CP013107.1 | Sinorhizobium americanum |
| 59 | 3705569 | 3705832 | + | NZ_CP010650.1 | Phaeobacter inhibens |
| 60 | 2429193 | 2429462 | + | NZ_CP034328.1 | Tabrizicola piscis |
| 61 | 3652719 | 3652982 | + | NZ_CP016364.1 | Phaeobacter porticola |
| 62 | 683072 | 683344 | + | NC_007626.1 | Magnetospirillum magneticum AMB-1 |
| 63 | 1186836 | 1187102 | + | NZ_CP017147.1 | Bosea vaviloviae |
| 64 | 10937551 | 10937826 | + | NZ_CP016211.1 | Minicystis rosea |
| 65 | 1084458 | 1084730 | + | NZ_LN907858.1 | Helicobacter typhlonius |
| 66 | 2442949 | 2443218 | - | NZ_CP025430.1 | Paracoccus zhejiangensis |
| 67 | 3339232 | 3339495 | - | NC_012982.1 | Hirschia baltica ATCC 49814 |
| 68 | 1084064 | 1084333 | - | NZ_LN832559.1 | Paracoccus aminovorans |
| 69 | 3270595 | 3270864 | + | NZ_CP038439.1 | Paracoccus liaowanqingii |
| 70 | 2474663 | 2474932 | - | NZ_CP025583.1 | Paracoccus jeotgali |
| 71 | 3671082 | 3671348 | + | NZ_CP023067.1 | Ensifer sojae CCBAU 05684 |
| 72 | 3689061 | 3689327 | + | NZ_CP034909.1 | Ensifer alkalisoli |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP040818.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF13649.8 | 0.74 | 53 | 2012.0 | opposite-strand | Methyltransferase domain |
| 2 | PF08241.14 | 0.74 | 53 | 2012.0 | opposite-strand | Methyltransferase domain |
| 3 | PF13489.8 | 0.71 | 51 | 1996 | opposite-strand | Methyltransferase domain |
| 4 | PF03109.18 | 0.69 | 50 | 2764.0 | opposite-strand | ABC1 atypical kinase-like domain |
| 5 | PF01209.20 | 0.71 | 51 | 1996 | opposite-strand | ubiE/COQ5 methyltransferase family |
| 6 | PF08242.14 | 0.72 | 52 | 2011 | opposite-strand | Methyltransferase domain |
| 7 | PF01149.26 | 0.79 | 57 | 1021 | same-strand | Formamidopyrimidine-DNA glycosylase N-terminal domain |
| 8 | PF06831.16 | 0.79 | 57 | 1021 | same-strand | Formamidopyrimidine-DNA glycosylase H2TH domain |
| 9 | PF06827.16 | 0.64 | 46 | 1016.0 | same-strand | Zinc finger found in FPG and IleRS |
| 10 | PF00378.22 | 0.75 | 54 | 178.0 | same-strand | Enoyl-CoA hydratase/isomerase |
++ More..