| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Protein YukE |
| NCBI Accession ID | AL009126.3 |
| Organism | Bacillus subtilis (strain 168) |
| Left | 3276141 |
| Right | 3276434 |
| Strand | - |
| Nucleotide Sequence | ATGGCAGGATTAATTCGTGTCACACCCGAAGAGCTAAGAGCGATGGCGAAGCAATACGGCGTTGAAAGCCAAGAAGTATTAAATCAGGTTGATCGTTTAAACCGAATGATCTCTGATTTGAAAAGCATGTGGGAAGGTGCTTCAAGCGAAGCGTTCGCAGATCAATACGAGCAGCTCAAACCTTCATTTATCAAAATGTCAGATTTGCTTCAAGATGTGAATCAGCAGCTTGATCAAACAGCAAATACACTTGAGTCTACTGACCAAGACATCGCAAATCAAATCCGCGGATAA |
| Sequence | MAGLIRVTPEELRAMAKQYGVESQEVLNQVDRLNRMISDLKSMWEGASSEAFADQYEQLKPSFIKMSDLLQDVNQQLDQTANTLESTDQDIANQIRG |
| Source of smORF | Swiss-Prot |
| Function | The ORF matches to the profile of cl02005. Profile Description: Proteins of 100 residues with WXG. T7SS_ESX-EspC is a family of exported virulence proteins from largely Acinetobacteria and a few Fimicutes, Gram-positive bacteria. It is exported in conjunction with EspA as an interacting pair.ED F8ADQ6.1/227-313; F8ADQ6.1/227-313; |
| Pubmed ID | 9168598 9384377 19383706 15576783 23861817 24798022 24828531 |
| Domain | CDD:413154 |
| Functional Category | Others |
| Uniprot ID | C0SP85 |
| ORF Length (Amino Acid) | 97 |
| Conservation Analysis |
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3139742 | 3140035 | - | NZ_CP033052.1 | Bacillus vallismortis |
| 2 | 3071443 | 3071736 | - | NZ_CP048852.1 | Bacillus tequilensis |
| 3 | 3062650 | 3062943 | - | NZ_CP051464.1 | Bacillus mojavensis |
| 4 | 3077007 | 3077300 | - | NZ_CP034943.1 | Bacillus subtilis subsp. spizizenii ATCC 6633 = JCM 2499 |
| 5 | 3140086 | 3140379 | - | NZ_CP013984.1 | Bacillus inaquosorum |
| 6 | 2986552 | 2986845 | + | NZ_CP029364.1 | Bacillus halotolerans |
| 7 | 3276141 | 3276434 | - | NC_000964.3 | Bacillus subtilis subsp. subtilis str. 168 |
| 8 | 914108 | 914401 | + | NZ_CP011937.1 | Bacillus velezensis |
| 9 | 3071557 | 3071850 | - | NZ_CP053376.1 | Bacillus amyloliquefaciens |
| 10 | 2506896 | 2507189 | + | NZ_CP017786.1 | Bacillus xiamenensis |
| 11 | 2897767 | 2898060 | - | NZ_CP011150.1 | Bacillus altitudinis |
| 12 | 2411942 | 2412235 | + | NZ_CP043404.1 | Bacillus safensis |
| 13 | 3232160 | 3232456 | - | NC_006270.3 | Bacillus licheniformis DSM 13 = ATCC 14580 |
| 14 | 3457381 | 3457677 | - | NZ_CP023665.1 | Bacillus paralicheniformis |
| 15 | 3635656 | 3635952 | - | NZ_LT603683.1 | Bacillus glycinifermentans |
| 16 | 2693240 | 2693533 | - | NZ_CP064060.1 | Anoxybacillus caldiproteolyticus |
| 17 | 3937660 | 3937953 | - | NZ_CP014616.1 | Sporosarcina psychrophila |
| 18 | 333065 | 333358 | + | NZ_CP024035.1 | Priestia aryabhattai |
| 19 | 895120 | 895413 | + | NZ_CP053989.1 | Niallia circulans |
| 20 | 129247 | 129540 | - | NZ_CP016622.1 | Parageobacillus thermoglucosidasius |
| 21 | 910948 | 911241 | + | NZ_CP070511.1 | Parageobacillus toebii |
| 22 | 368938 | 369231 | + | NZ_CP015378.1 | Fictibacillus phosphorivorans |
| 23 | 4324326 | 4324619 | + | NZ_CP016020.1 | Bacillus weihaiensis |
| 24 | 2217840 | 2218130 | - | NZ_CP017704.1 | Peribacillus simplex NBRC 15720 = DSM 1321 |
| 25 | 2826903 | 2827193 | + | NZ_CP030926.1 | Peribacillus butanolivorans |
| 26 | 798431 | 798724 | + | NZ_AP021853.1 | Sporolactobacillus terrae |
| 27 | 2987297 | 2987590 | - | NZ_AP021853.1 | Sporolactobacillus terrae |
| 28 | 1493483 | 1493776 | - | NZ_CP022983.1 | Cytobacillus kochii |
| 29 | 302632 | 302925 | + | NC_013791.2 | Alkalihalobacillus pseudofirmus OF4 |
| 30 | 2970392 | 2970685 | - | NZ_CP022437.1 | Virgibacillus necropolis |
| Neighborhood Conservation Analysis |
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF17355.4 | 0.97 | 28 | 9195.5 | same-strand | Family of unknown function (DUF5383) |
| 2 | PF12538.10 | 1.0 | 29 | 1709 | same-strand | DNA transporter |
| 3 | PF13401.8 | 0.97 | 28 | 1712.0 | same-strand | AAA domain |
| 4 | PF10140.11 | 1.0 | 29 | 334 | same-strand | WXG100 protein secretion system (Wss), protein YukC |
| 5 | PF08817.12 | 0.97 | 28 | 79.5 | same-strand | WXG100 protein secretion system (Wss), protein YukD |
| 6 | PF01580.20 | 0.97 | 28 | 1708.0 | same-strand | FtsK/SpoIIIE family |