Result : A1SER2
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Translational regulator CsrA |
| NCBI Accession ID | CP000509.1 |
| Organism | Nocardioides sp. (strain ATCC BAA-499 / JS614) |
| Left | 815723 |
| Right | 815974 |
| Strand | + |
| Nucleotide Sequence | ATGCTGGTCTTGAGCCGTCGTGCCGGAGAGAGCGTGGTGCTCGGCGAGGACGTCGTCGTGACGATCCTCGAGGTCCGCGGCGACGTCGTCCGGGTCGGCATCGACGCGCCCCGCTCGGTCAGGGTGCACCGCGCCGAGCTGCTCGCCCAGCTCGAGGAGACCAACCGCCAGGCCGCGTCCCCCAGCGAGGACGTGATCGCCAACCTGGCCCGCGCCCTCGACCACGGCACCGGCACCGACCCCTCCTCCTGA |
| Sequence | MLVLSRRAGESVVLGEDVVVTILEVRGDVVRVGIDAPRSVRVHRAELLAQLEETNRQAASPSEDVIANLARALDHGTGTDPSS |
| Source of smORF | Swiss-Prot |
| Function | A translational regulator that binds mRNA to regulate translation initiation and/or mRNA stability. Usually binds in the 5'-UTR at or near the Shine-Dalgarno sequence preventing ribosome-binding, thus repressing translation. Its main target seems to be the major flagellin gene, while its function is anatagonized by FliW. {ECO:0000255|HAMAP-Rule:MF_00167}. |
| Pubmed ID | |
| Domain | CDD:412510 |
| Functional Category | RNA-binding |
| Uniprot ID | A1SER2 |
| ORF Length (Amino Acid) | 83 |
++ More..
| Conservation Analysis |
No. of Species: 13
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1850401 | 1850637 | - | NZ_CP038267.1 | Nocardioides euryhalodurans |
| 2 | 1452468 | 1452716 | + | NZ_CP038436.1 | Nocardioides seonyuensis |
| 3 | 1091317 | 1091580 | + | NZ_CP009896.1 | Pimelobacter simplex |
| 4 | 1279797 | 1280033 | + | NZ_CP049257.1 | Nocardioides anomalus |
| 5 | 8234375 | 8234617 | - | NC_017093.1 | Actinoplanes missouriensis 431 |
| 6 | 7757135 | 7757377 | - | NZ_CP023865.1 | Actinoplanes teichomyceticus ATCC 31121 |
| 7 | 1608660 | 1608905 | - | NZ_CP041146.1 | Nocardioides humi |
| 8 | 8803785 | 8804036 | - | NC_022657.1 | Actinoplanes friuliensis DSM 7358 |
| 9 | 1120220 | 1120465 | + | NZ_CP022295.1 | Nocardioides aromaticivorans |
| 10 | 3049851 | 3050114 | - | NC_014098.1 | Kyrpidia tusciae DSM 2912 |
| 11 | 2987786 | 2988055 | - | NZ_CP024955.1 | Kyrpidia spormannii |
| 12 | 42833 | 43072 | + | NC_011961.1 | Thermomicrobium roseum DSM 5159 |
| 13 | 524688 | 524924 | - | NC_009664.2 | Kineococcus radiotolerans SRS30216 = ATCC BAA-149 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP038436.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02623.17 | 0.92 | 12 | 42.0 | same-strand | FliW protein |
| 2 | PF00669.22 | 0.92 | 12 | 495 | same-strand | Bacterial flagellin N-terminal helical region |
| 3 | PF00700.23 | 0.92 | 12 | 495 | same-strand | Bacterial flagellin C-terminal helical region |
| 4 | PF05130.14 | 0.85 | 11 | 2801 | same-strand | FlgN protein |
| 5 | PF00460.22 | 0.77 | 10 | 1458.0 | same-strand | Flagella basal body rod protein |
++ More..