Result : EXP04251
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP04251 |
| NCBI Accession ID | NC_004663.1 |
| Organism | Bacteroides thetaiotaomicron VPI-5482 |
| Left | 4846729 |
| Right | 4846839 |
| Strand | - |
| Nucleotide Sequence | ATGAACAAGAAAACTGAAAAGAAACAGGAAGAGGCAAAGGGCACTAAAAAGACCGCCCAAGCTAAAGAGTGCAAGTCTTCGACTTCAAGCAAAAAAACTGAAAAGAAATAG |
| Sequence | MNKKTEKKQEEAKGTKKTAQAKECKSSTSSKKTEKK |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 31402174 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 36 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2148108 | 2148218 | - | NZ_CP040530.1 | Bacteroides thetaiotaomicron |
| 2 | 2643771 | 2643878 | - | NZ_CP015401.2 | Bacteroides caecimuris |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP040530.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF12732.9 | 1.0 | 2 | 698.5 | same-strand | YtxH-like protein |
| 2 | PF12833.9 | 1.0 | 2 | 3436.0 | both-strands | Helix-turn-helix domain |
| 3 | PF00165.25 | 1.0 | 2 | 3436.0 | both-strands | Bacterial regulatory helix-turn-helix proteins, AraC family |
++ More..