Result : EXP04226
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP04226 |
| NCBI Accession ID | NZ_CP027540.1 |
| Organism | S. pneumoniae D39V |
| Left | 1528556 |
| Right | 1528618 |
| Strand | - |
| Nucleotide Sequence | ATGACAGTAACGATTAAAGTAAATTACCAAACCACTTTCCAAAAGAAGGAAGCAAAAAACTAG |
| Sequence | MTVTIKVNYQTTFQKKEAKN |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 35852327 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 20 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1288973 | 1289035 | - | NZ_CP032621.1 | Streptococcus gwangjuense |
| 2 | 1604725 | 1604787 | - | NC_015875.1 | Streptococcus pseudopneumoniae IS7493 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP032621.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02973.18 | 1.0 | 2 | 1877.5 | same-strand | Sialidase, N-terminal domain |
| 2 | PF13385.8 | 1.0 | 2 | 1877.5 | same-strand | Concanavalin A-like lectin/glucanases superfamily |
| 3 | PF04650.19 | 1.0 | 2 | 1702.5 | same-strand | YSIRK type signal peptide |
| 4 | PF00271.33 | 1.0 | 2 | 82.0 | same-strand | Helicase conserved C-terminal domain |
| 5 | PF00270.31 | 1.0 | 2 | 82.0 | same-strand | DEAD/DEAH box helicase |
| 6 | PF17191.6 | 1.0 | 2 | 82.0 | same-strand | RecG wedge domain |
| 7 | PF04851.17 | 1.0 | 2 | 82.0 | same-strand | Type III restriction enzyme, res subunit |
| 8 | PF19833.1 | 1.0 | 2 | 82.0 | same-strand | ATP-dependent DNA helicase RecG C-terminal |
| 9 | PF01168.22 | 1.0 | 2 | 2116.0 | same-strand | Alanine racemase, N-terminal domain |
| 10 | PF00842.23 | 1.0 | 2 | 2116.0 | same-strand | Alanine racemase, C-terminal domain |
| 11 | PF01648.22 | 1.0 | 2 | 3209.0 | same-strand | 4'-phosphopantetheinyl transferase superfamily |
| 12 | PF17837.3 | 1.0 | 2 | 3209.0 | same-strand | 4'-phosphopantetheinyl transferase N-terminal domain |
| 13 | PF00793.22 | 1.0 | 2 | 4132.5 | same-strand | DAHP synthetase I family |
++ More..