Result : EXP04225
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP04225 |
| NCBI Accession ID | NZ_CP027540.1 |
| Organism | S. pneumoniae D39V |
| Left | 1457861 |
| Right | 1457905 |
| Strand | - |
| Nucleotide Sequence | TTGGTTACAGGCATGCCAACCTGTCACTCGGATGAAGCCAAATAA |
| Sequence | LVTGMPTCHSDEAK |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 35852327 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 14 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1247532 | 1247576 | - | NZ_CP032621.1 | Streptococcus gwangjuense |
| 2 | 1526841 | 1526885 | - | NC_015875.1 | Streptococcus pseudopneumoniae IS7493 |
| 3 | 1376320 | 1376364 | - | NZ_LR134336.1 | Streptococcus oralis ATCC 35037 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP032621.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01497.20 | 0.67 | 2 | 3792.5 | same-strand | Periplasmic binding protein |
| 2 | PF00005.29 | 0.67 | 2 | 2798 | same-strand | ABC transporter |
| 3 | PF01032.20 | 0.67 | 2 | 1969.5 | same-strand | FecCD transport family |
| 4 | PF03596.15 | 1.0 | 3 | 1099 | same-strand | Cadmium resistance transporter |
| 5 | PF03741.18 | 1.0 | 3 | 1099 | same-strand | Integral membrane protein TerC family |
| 6 | PF00312.24 | 1.0 | 3 | 15 | same-strand | Ribosomal protein S15 |
| 7 | PF07580.16 | 0.67 | 2 | 4450 | same-strand | M26 IgA1-specific Metallo-endopeptidase C-terminal region |
| 8 | PF05342.16 | 0.67 | 2 | 4450 | same-strand | M26 IgA1-specific Metallo-endopeptidase N-terminal region |
| 9 | PF07501.14 | 0.67 | 2 | 4450 | same-strand | G5 domain |
| 10 | PF00746.23 | 0.67 | 2 | 3053.0 | same-strand | LPXTG cell wall anchor motif |
| 11 | PF04650.19 | 0.67 | 2 | 4450 | same-strand | YSIRK type signal peptide |
++ More..