Protein Information |
Information Type | Description |
---|---|
Protein name | EXP04224 |
NCBI Accession ID | NZ_CP027540.1 |
Organism | S. pneumoniae D39V |
Left | 1456875 |
Right | 1456949 |
Strand | - |
Nucleotide Sequence | ATGCTTTCCTACGTTCGACATTACCCACTAGCGATAGCTAAATTAATGTGTCTGTGCTCTCCTAAAATCTGCTGA |
Sequence | MLSYVRHYPLAIAKLMCLCSPKIC |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 35852327 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 24 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 1525772 | 1525846 | - | NC_015875.1 | Streptococcus pseudopneumoniae IS7493 |
2 | 1246658 | 1246732 | - | NZ_CP032621.1 | Streptococcus gwangjuense |
3 | 1374935 | 1375009 | - | NZ_LR134336.1 | Streptococcus oralis ATCC 35037 |
4 | 650238 | 650312 | - | NZ_CP044499.1 | Lapidilactobacillus dextrinicus |
5 | 892641 | 892715 | + | NZ_CP018888.1 | Amylolactobacillus amylophilus DSM 20533 = JCM 1125 |
6 | 1904492 | 1904566 | - | NZ_CP014164.1 | Aerococcus viridans |
7 | 1976293 | 1976373 | - | NZ_CP023434.1 | Suicoccus acidiformans |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF03596.15 | 1.0 | 7 | 30 | same-strand | Cadmium resistance transporter |