Result : EXP04224
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP04224 |
| NCBI Accession ID | NZ_CP027540.1 |
| Organism | S. pneumoniae D39V |
| Left | 1456875 |
| Right | 1456949 |
| Strand | - |
| Nucleotide Sequence | ATGCTTTCCTACGTTCGACATTACCCACTAGCGATAGCTAAATTAATGTGTCTGTGCTCTCCTAAAATCTGCTGA |
| Sequence | MLSYVRHYPLAIAKLMCLCSPKIC |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 35852327 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 24 |
++ More..
| Conservation Analysis |
No. of Species: 7
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1525772 | 1525846 | - | NC_015875.1 | Streptococcus pseudopneumoniae IS7493 |
| 2 | 1246658 | 1246732 | - | NZ_CP032621.1 | Streptococcus gwangjuense |
| 3 | 1374935 | 1375009 | - | NZ_LR134336.1 | Streptococcus oralis ATCC 35037 |
| 4 | 650238 | 650312 | - | NZ_CP044499.1 | Lapidilactobacillus dextrinicus |
| 5 | 892641 | 892715 | + | NZ_CP018888.1 | Amylolactobacillus amylophilus DSM 20533 = JCM 1125 |
| 6 | 1904492 | 1904566 | - | NZ_CP014164.1 | Aerococcus viridans |
| 7 | 1976293 | 1976373 | - | NZ_CP023434.1 | Suicoccus acidiformans |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015875.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03596.15 | 1.0 | 7 | 30 | same-strand | Cadmium resistance transporter |
++ More..