Result : EXP04218
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP04218 |
| NCBI Accession ID | NZ_CP027540.1 |
| Organism | S. pneumoniae D39V |
| Left | 1250035 |
| Right | 1250073 |
| Strand | - |
| Nucleotide Sequence | TTGAATGAAGGTGGTACCGCGGTTTTTCGCCCTTCGTGA |
| Sequence | LNEGGTAVFRPS |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 35852327 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 12 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1309495 | 1309533 | - | NC_015875.1 | Streptococcus pseudopneumoniae IS7493 |
| 2 | 1608408 | 1608446 | - | NZ_LR594049.1 | Streptococcus gordonii |
| 3 | 1075058 | 1075096 | - | NZ_CP032621.1 | Streptococcus gwangjuense |
| 4 | 1201203 | 1201241 | - | NZ_LR134336.1 | Streptococcus oralis ATCC 35037 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015875.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00005.29 | 0.75 | 3 | 4055.0 | same-strand | ABC transporter |
| 2 | PF00128.26 | 0.75 | 3 | 3248 | opposite-strand | Alpha amylase, catalytic domain |
| 3 | PF09154.12 | 0.75 | 3 | 3248 | opposite-strand | Domain of unknown function (DUF1939) |
| 4 | PF01411.21 | 1.0 | 4 | 541.0 | same-strand | tRNA synthetases class II (A) |
| 5 | PF02272.21 | 1.0 | 4 | 541.0 | same-strand | DHHA1 domain |
| 6 | PF07973.16 | 1.0 | 4 | 541.0 | same-strand | Threonyl and Alanyl tRNA synthetase second additional domain |
| 7 | PF04525.14 | 1.0 | 4 | 34.0 | same-strand | LURP-one-related |
| 8 | PF13416.8 | 0.75 | 3 | 606 | same-strand | Bacterial extracellular solute-binding protein |
| 9 | PF13343.8 | 0.75 | 3 | 606 | same-strand | Bacterial extracellular solute-binding protein |
| 10 | PF01547.27 | 0.75 | 3 | 606 | same-strand | Bacterial extracellular solute-binding protein |
| 11 | PF13531.8 | 0.75 | 3 | 606 | same-strand | Bacterial extracellular solute-binding protein |
++ More..