Result : EXP04194
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP04194 |
| NCBI Accession ID | NZ_CP027540.1 |
| Organism | S. pneumoniae D39V |
| Left | 767622 |
| Right | 767705 |
| Strand | + |
| Nucleotide Sequence | TTGAAAGACGTGAATGATATGAACATGTCCTTGCTGGTGCTTAGGAAAAAAATTATAAGTATGTCAAGTTTAAGAAAAACTTGA |
| Sequence | LKDVNDMNMSLLVLRKKIISMSSLRKT |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 35852327 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 27 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 588360 | 588443 | + | NZ_CP032621.1 | Streptococcus gwangjuense |
| 2 | 1109681 | 1109755 | - | NZ_LR134336.1 | Streptococcus oralis ATCC 35037 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP032621.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00521.22 | 1.0 | 2 | 2756.5 | same-strand | DNA gyrase/topoisomerase IV, subunit A |
| 2 | PF03989.15 | 1.0 | 2 | 2756.5 | same-strand | DNA gyrase C-terminal domain, beta-propeller |
| 3 | PF01063.21 | 1.0 | 2 | 1601.5 | same-strand | Amino-transferase class IV |
| 4 | PF11184.10 | 1.0 | 2 | 270.5 | same-strand | Protein of unknown function (DUF2969) |
| 5 | PF00575.25 | 1.0 | 2 | 25.5 | same-strand | S1 RNA binding domain |
| 6 | PF13177.8 | 1.0 | 2 | 1809.0 | same-strand | DNA polymerase III, delta subunit |
| 7 | PF00004.31 | 1.0 | 2 | 1809.0 | same-strand | ATPase family associated with various cellular activities (AAA) |
| 8 | PF12169.10 | 1.0 | 2 | 1809.0 | same-strand | DNA polymerase III subunits gamma and tau domain III |
| 9 | PF13401.8 | 1.0 | 2 | 1809.0 | same-strand | AAA domain |
| 10 | PF00005.29 | 1.0 | 2 | 3838.5 | same-strand | ABC transporter |
| 11 | PF02463.21 | 1.0 | 2 | 3838.5 | same-strand | RecF/RecN/SMC N terminal domain |
++ More..