Result : EXP04190
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP04190 |
| NCBI Accession ID | NZ_CP027540.1 |
| Organism | S. pneumoniae D39V |
| Left | 676352 |
| Right | 676426 |
| Strand | + |
| Nucleotide Sequence | ATGGACATTTCAGTAATTCGTCAGAAAATTGACGCAAATCGTGAAAAATTAGCTTATTTCAGGGGGTCTCTTTGA |
| Sequence | MDISVIRQKIDANREKLAYFRGSL |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 35852327 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 24 |
++ More..
| Conservation Analysis |
No. of Species: 55
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 729096 | 729170 | + | NC_015875.1 | Streptococcus pseudopneumoniae IS7493 |
| 2 | 1476440 | 1476514 | - | NZ_LR594049.1 | Streptococcus gordonii |
| 3 | 1279186 | 1279260 | + | NZ_CP032620.1 | Streptococcus koreensis |
| 4 | 1265668 | 1265742 | - | NZ_LS483383.1 | Streptococcus cristatus ATCC 51100 |
| 5 | 611485 | 611559 | + | NZ_LS483436.1 | Streptococcus intermedius |
| 6 | 574627 | 574701 | + | NZ_LR134336.1 | Streptococcus oralis ATCC 35037 |
| 7 | 619428 | 619502 | + | NZ_CP012805.1 | Streptococcus anginosus |
| 8 | 568100 | 568174 | + | NZ_CP034543.1 | Streptococcus periodonticum |
| 9 | 478419 | 478493 | + | NZ_CP032621.1 | Streptococcus gwangjuense |
| 10 | 1286526 | 1286600 | + | NZ_CP016953.1 | Streptococcus himalayensis |
| 11 | 1098308 | 1098382 | - | NZ_LT906439.1 | Streptococcus merionis |
| 12 | 1509695 | 1509769 | + | NZ_CP015196.1 | Streptococcus marmotae |
| 13 | 1954408 | 1954482 | + | NZ_LR134341.1 | Streptococcus pseudoporcinus |
| 14 | 531076 | 531150 | + | NZ_LR134512.1 | Streptococcus agalactiae |
| 15 | 1236469 | 1236543 | - | NZ_LR594050.1 | Streptococcus porcinus |
| 16 | 517287 | 517361 | + | NZ_CP010450.1 | Streptococcus pyogenes |
| 17 | 1448148 | 1448222 | - | NZ_CP039457.1 | Streptococcus pasteurianus |
| 18 | 1226493 | 1226567 | - | NZ_LS483403.1 | Streptococcus lutetiensis |
| 19 | 2215383 | 2215457 | - | NZ_CP059540.1 | Planococcus maritimus |
| 20 | 2193324 | 2193398 | - | NZ_CP016538.2 | Planococcus maritimus |
| 21 | 1474277 | 1474351 | - | NZ_CP012047.1 | Tetragenococcus halophilus |
| 22 | 1537956 | 1538030 | - | NZ_CP029491.1 | Streptococcus sobrinus |
| 23 | 712698 | 712772 | + | NZ_LR594046.1 | Streptococcus dysgalactiae |
| 24 | 1721483 | 1721557 | - | NZ_CP022680.1 | Streptococcus respiraculi |
| 25 | 108416 | 108490 | - | NZ_CP054015.1 | Streptococcus gallolyticus |
| 26 | 1128908 | 1128982 | + | NZ_CP014163.1 | Aerococcus urinaehominis |
| 27 | 1265514 | 1265588 | - | NZ_LS483343.1 | Streptococcus ferus |
| 28 | 56814 | 56888 | + | NZ_CP014835.1 | Streptococcus halotolerans |
| 29 | 1957962 | 1958036 | - | NZ_LR134293.1 | Streptococcus canis |
| 30 | 1394527 | 1394601 | + | NZ_CP043405.1 | Streptococcus ratti |
| 31 | 1358404 | 1358478 | - | NZ_CP025536.1 | Streptococcus pluranimalium |
| 32 | 1990807 | 1990881 | - | NZ_CP013659.2 | Planococcus rifietoensis |
| 33 | 2095303 | 2095377 | - | NZ_CP008724.1 | Staphylococcus xylosus |
| 34 | 1361093 | 1361167 | - | NC_012924.1 | Streptococcus suis SC84 |
| 35 | 2173131 | 2173205 | - | NZ_CP016539.2 | Planococcus plakortidis |
| 36 | 1265482 | 1265556 | - | NZ_CP065061.1 | Streptococcus equi subsp. zooepidemicus |
| 37 | 3581789 | 3581863 | - | NZ_CP014616.1 | Sporosarcina psychrophila |
| 38 | 1381685 | 1381759 | + | NZ_CP020772.1 | Halobacillus mangrovi |
| 39 | 1049278 | 1049352 | - | NZ_LR134275.1 | Streptococcus vestibularis |
| 40 | 1101493 | 1101567 | - | NC_017581.1 | Streptococcus thermophilus JIM 8232 |
| 41 | 4835373 | 4835447 | - | NZ_CP024035.1 | Priestia aryabhattai |
| 42 | 1508359 | 1508433 | - | NZ_AP018400.1 | Streptococcus ruminantium |
| 43 | 1671668 | 1671742 | - | NZ_CP031733.1 | Streptococcus chenjunshii |
| 44 | 596175 | 596249 | + | NZ_CP014699.1 | Streptococcus pantholopis |
| 45 | 1319669 | 1319743 | - | NZ_CP018199.1 | Staphylococcus succinus |
| 46 | 858479 | 858553 | + | NC_014334.2 | Lacticaseibacillus paracasei |
| 47 | 3101495 | 3101569 | + | NZ_CP009709.1 | Weizmannia coagulans DSM 1 = ATCC 7050 |
| 48 | 2436900 | 2436974 | - | NZ_CP016537.2 | Planococcus halocryophilus |
| 49 | 2328252 | 2328326 | - | NZ_CP016543.2 | Planococcus donghaensis |
| 50 | 2631369 | 2631443 | - | NZ_CP016534.2 | Planococcus antarcticus DSM 14505 |
| 51 | 2487624 | 2487698 | - | NZ_CP019401.1 | Planococcus faecalis |
| 52 | 2774618 | 2774692 | + | NZ_CP013661.2 | Planococcus kocurii |
| 53 | 2346861 | 2346935 | - | NZ_CP016540.2 | Planococcus versutus |
| 54 | 2007378 | 2007452 | - | NZ_LR134089.1 | Staphylococcus saprophyticus |
| 55 | 655165 | 655239 | - | NZ_CP053988.1 | Abiotrophia defectiva |
| 56 | 2055726 | 2055800 | - | NZ_CP018061.1 | Enterococcus mundtii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015875.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00005.29 | 0.91 | 50 | 1126 | same-strand | ABC transporter |
| 2 | PF03462.20 | 1.0 | 55 | 44.0 | same-strand | PCRF domain |
| 3 | PF00472.22 | 1.0 | 55 | 44.0 | same-strand | RF-1 domain |
| 4 | PF18075.3 | 0.84 | 46 | 1784.5 | same-strand | FtsX extracellular domain |
| 5 | PF02687.23 | 0.84 | 46 | 1784.5 | same-strand | FtsX-like permease family |
++ More..