Result : EXP04189
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP04189 |
| NCBI Accession ID | NZ_CP027540.1 |
| Organism | S. pneumoniae D39V |
| Left | 669265 |
| Right | 669354 |
| Strand | + |
| Nucleotide Sequence | ATGACTTGGAAAAGTATTTCCAGTCACGAAAGGAGGTTGGGTTTTTGTTTCTGTCTAATGAAAGCAGAGCAAAAATTTGACCTTTTTTGA |
| Sequence | MTWKSISSHERRLGFCFCLMKAEQKFDLF |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 35852327 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 29 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 722315 | 722404 | + | NC_015875.1 | Streptococcus pseudopneumoniae IS7493 |
| 2 | 425447 | 425536 | + | NZ_CP032621.1 | Streptococcus gwangjuense |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015875.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03486.16 | 1.0 | 2 | 2855.0 | opposite-strand | HI0933-like protein |
| 2 | PF02645.18 | 1.0 | 2 | 1905.5 | opposite-strand | Uncharacterised protein, DegV family COG1307 |
| 3 | PF00440.25 | 1.0 | 2 | 1223.5 | same-strand | Bacterial regulatory proteins, tetR family |
| 4 | PF00383.25 | 1.0 | 2 | 737.5 | same-strand | Cytidine and deoxycytidylate deaminase zinc-binding region |
| 5 | PF14681.8 | 1.0 | 2 | 14.5 | same-strand | Uracil phosphoribosyltransferase |
| 6 | PF00574.25 | 1.0 | 2 | 70.0 | same-strand | Clp protease |
| 7 | PF09902.11 | 1.0 | 2 | 739.5 | same-strand | Uncharacterized protein conserved in bacteria (DUF2129) |
| 8 | PF13458.8 | 1.0 | 2 | 1088.5 | same-strand | Periplasmic binding protein |
| 9 | PF01094.30 | 1.0 | 2 | 1088.5 | same-strand | Receptor family ligand binding region |
| 10 | PF13433.8 | 1.0 | 2 | 1088.5 | same-strand | Periplasmic binding protein domain |
| 11 | PF02653.18 | 1.0 | 2 | 2802.0 | same-strand | Branched-chain amino acid transport system / permease component |
++ More..