Result : EXP04182
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP04182 |
| NCBI Accession ID | NZ_CP027540.1 |
| Organism | S. pneumoniae D39V |
| Left | 444912 |
| Right | 444977 |
| Strand | + |
| Nucleotide Sequence | CTGGTGCAGTCGTCCCAGATTATTCTTATTAGTAGGGTCTTGTTTTCTATATCCCCTCGTAGTTAA |
| Sequence | LVQSSQIILISRVLFSISPRS |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 35852327 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 21 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 525973 | 526035 | + | NC_015875.1 | Streptococcus pseudopneumoniae IS7493 |
| 2 | 1387486 | 1387548 | - | NZ_CP032621.1 | Streptococcus gwangjuense |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015875.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF05066.15 | 1.0 | 2 | 218.5 | same-strand | HB1, ASXL, restriction endonuclease HTH domain |
| 2 | PF06418.16 | 1.0 | 2 | 33.0 | same-strand | CTP synthase N-terminus |
| 3 | PF00117.30 | 1.0 | 2 | 33.0 | same-strand | Glutamine amidotransferase class-I |
++ More..