Result : EXP04177
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP04177 |
| NCBI Accession ID | NZ_CP027540.1 |
| Organism | S. pneumoniae D39V |
| Left | 306391 |
| Right | 306480 |
| Strand | + |
| Nucleotide Sequence | ATGTTTCATCTAGAAATCTTCAGAAGTAAAGATAGTCTACTCCTGCTTGAAAAAGAAAAACCGGAAATAGTACATAGAGTAGCGATTTAG |
| Sequence | MFHLEIFRSKDSLLLLEKEKPEIVHRVAI |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 35852327 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 29 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 403943 | 404032 | + | NC_015875.1 | Streptococcus pseudopneumoniae IS7493 |
| 2 | 108007 | 108096 | + | NZ_CP032621.1 | Streptococcus gwangjuense |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015875.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF07724.16 | 1.0 | 2 | 84.0 | same-strand | AAA domain (Cdc48 subfamily) |
| 2 | PF00004.31 | 1.0 | 2 | 84.0 | same-strand | ATPase family associated with various cellular activities (AAA) |
| 3 | PF17871.3 | 1.0 | 2 | 84.0 | same-strand | AAA lid domain |
| 4 | PF10431.11 | 1.0 | 2 | 84.0 | same-strand | C-terminal, D2-small domain, of ClpB protein |
| 5 | PF07728.16 | 1.0 | 2 | 84.0 | same-strand | AAA domain (dynein-related subfamily) |
| 6 | PF02664.17 | 1.0 | 2 | 2366.0 | opposite-strand | S-Ribosylhomocysteinase (LuxS) |
++ More..