Result : EXP04176
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP04176 |
| NCBI Accession ID | NZ_CP027540.1 |
| Organism | S. pneumoniae D39V |
| Left | 272815 |
| Right | 272874 |
| Strand | + |
| Nucleotide Sequence | TTGAAAGGCCCCGGAACCTTCCAAATACTTTTCGATGGGAAGGAACACCCATCACCGTAA |
| Sequence | LKGPGTFQILFDGKEHPSP |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 35852327 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 19 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 423051 | 423110 | + | NC_015875.1 | Streptococcus pseudopneumoniae IS7493 |
| 2 | 1492098 | 1492157 | - | NZ_CP032621.1 | Streptococcus gwangjuense |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015875.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00572.20 | 1.0 | 2 | 31.0 | same-strand | Ribosomal protein L13 |
| 2 | PF00380.21 | 1.0 | 2 | 496.5 | same-strand | Ribosomal protein S9/S16 |
++ More..