Result : EXP04173
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP04173 |
| NCBI Accession ID | NZ_CP027540.1 |
| Organism | S. pneumoniae D39V |
| Left | 202954 |
| Right | 203037 |
| Strand | + |
| Nucleotide Sequence | TTGACGAAGAAACTAAAGTTTCTAGGAAAGTTTATCTTTTTCACACAGAGTTTAGCCCGGGTTCAATTGGGCTTGCCAATTTGA |
| Sequence | LTKKLKFLGKFIFFTQSLARVQLGLPI |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 35852327 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 27 |
++ More..
| Conservation Analysis |
No. of Species: 9
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1758072 | 1758155 | - | NZ_LS483436.1 | Streptococcus intermedius |
| 2 | 606 | 689 | + | NZ_CP032621.1 | Streptococcus gwangjuense |
| 3 | 1247121 | 1247201 | - | NZ_CP032621.1 | Streptococcus gwangjuense |
| 4 | 1749808 | 1749891 | - | NZ_LR134336.1 | Streptococcus oralis ATCC 35037 |
| 5 | 1526430 | 1526510 | - | NC_015875.1 | Streptococcus pseudopneumoniae IS7493 |
| 6 | 360200 | 360280 | + | NZ_LR594049.1 | Streptococcus gordonii |
| 7 | 359815 | 359895 | + | NZ_LR594049.1 | Streptococcus gordonii |
| 8 | 1076988 | 1077083 | - | NZ_CP022680.1 | Streptococcus respiraculi |
| 9 | 92599 | 92688 | + | NZ_LS483383.1 | Streptococcus cristatus ATCC 51100 |
| 10 | 290390 | 290482 | - | NZ_AP018400.1 | Streptococcus ruminantium |
| 11 | 272194 | 272271 | + | NZ_CP029491.1 | Streptococcus sobrinus |
++ More..