Result : EXP04172
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP04172 |
| NCBI Accession ID | NZ_CP027540.1 |
| Organism | S. pneumoniae D39V |
| Left | 195901 |
| Right | 195972 |
| Strand | + |
| Nucleotide Sequence | TTGATGCAAGAGGTTGCGACACGCTCGGTTGCATTGCCACGCAACACCGCGTCGGTTTTCTTGTGGAGCTAG |
| Sequence | LMQEVATRSVALPRNTASVFLWS |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 35852327 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 23 |
++ More..
| Conservation Analysis |
No. of Species: 18
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 290577 | 290648 | + | NC_015875.1 | Streptococcus pseudopneumoniae IS7493 |
| 2 | 1966117 | 1966188 | + | NZ_CP032621.1 | Streptococcus gwangjuense |
| 3 | 1784453 | 1784524 | - | NZ_CP012805.1 | Streptococcus anginosus |
| 4 | 2038973 | 2039044 | - | NZ_LR594049.1 | Streptococcus gordonii |
| 5 | 1719943 | 1720014 | - | NZ_CP034543.1 | Streptococcus periodonticum |
| 6 | 1764918 | 1764989 | - | NZ_LS483436.1 | Streptococcus intermedius |
| 7 | 85211 | 85282 | + | NZ_LS483383.1 | Streptococcus cristatus ATCC 51100 |
| 8 | 104695 | 104766 | + | NZ_LS483343.1 | Streptococcus ferus |
| 9 | 495375 | 495446 | - | NZ_CP016953.1 | Streptococcus himalayensis |
| 10 | 488585 | 488656 | + | NZ_CP022680.1 | Streptococcus respiraculi |
| 11 | 1917612 | 1917683 | - | NZ_AP014612.1 | Streptococcus troglodytae |
| 12 | 80815 | 80886 | + | NZ_CP031733.1 | Streptococcus chenjunshii |
| 13 | 2165649 | 2165720 | + | NZ_CP014699.1 | Streptococcus pantholopis |
| 14 | 1748105 | 1748176 | + | NZ_CP013237.1 | Streptococcus mutans |
| 15 | 869537 | 869608 | + | NZ_CP054015.1 | Streptococcus gallolyticus |
| 16 | 90772 | 90843 | + | NZ_CP029491.1 | Streptococcus sobrinus |
| 17 | 61890 | 61961 | + | NZ_LS483403.1 | Streptococcus lutetiensis |
| 18 | 70975 | 71046 | + | NZ_CP039457.1 | Streptococcus pasteurianus |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015875.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00338.24 | 1.0 | 18 | 35.0 | same-strand | Ribosomal protein S10p/S20e |
| 2 | PF00573.24 | 1.0 | 18 | 1171.5 | same-strand | Ribosomal protein L4/L1 family |
| 3 | PF00276.22 | 1.0 | 18 | 1794.5 | same-strand | Ribosomal protein L23 |
| 4 | PF03947.20 | 1.0 | 18 | 2111.5 | same-strand | Ribosomal Proteins L2, C-terminal domain |
| 5 | PF00181.25 | 1.0 | 18 | 2111.5 | same-strand | Ribosomal Proteins L2, RNA binding domain |
++ More..