Protein Information |
Information Type | Description |
---|---|
Protein name | EXP04171 |
NCBI Accession ID | NZ_CP027540.1 |
Organism | S. pneumoniae D39V |
Left | 195914 |
Right | 195985 |
Strand | + |
Nucleotide Sequence | TTGCGACACGCTCGGTTGCATTGCCACGCAACACCGCGTCGGTTTTCTTGTGGAGCTAGCCTATTATCTTAA |
Sequence | LRHARLHCHATPRRFSCGASLLS |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 35852327 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 23 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 290590 | 290661 | + | NC_015875.1 | Streptococcus pseudopneumoniae IS7493 |
2 | 1966130 | 1966201 | + | NZ_CP032621.1 | Streptococcus gwangjuense |
3 | 1719930 | 1720001 | - | NZ_CP034543.1 | Streptococcus periodonticum |
4 | 2038960 | 2039031 | - | NZ_LR594049.1 | Streptococcus gordonii |
5 | 1784440 | 1784511 | - | NZ_CP012805.1 | Streptococcus anginosus |
6 | 495362 | 495433 | - | NZ_CP016953.1 | Streptococcus himalayensis |
7 | 85224 | 85295 | + | NZ_LS483383.1 | Streptococcus cristatus ATCC 51100 |
8 | 104708 | 104779 | + | NZ_LS483343.1 | Streptococcus ferus |
9 | 488598 | 488669 | + | NZ_CP022680.1 | Streptococcus respiraculi |
10 | 1764905 | 1764976 | - | NZ_LS483436.1 | Streptococcus intermedius |
11 | 1917599 | 1917670 | - | NZ_AP014612.1 | Streptococcus troglodytae |
12 | 1748118 | 1748189 | + | NZ_CP013237.1 | Streptococcus mutans |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00338.24 | 1.0 | 12 | 22.0 | same-strand | Ribosomal protein S10p/S20e |
2 | PF00573.24 | 1.0 | 12 | 1188.0 | same-strand | Ribosomal protein L4/L1 family |
3 | PF00276.22 | 1.0 | 12 | 1811.0 | same-strand | Ribosomal protein L23 |
4 | PF03947.20 | 1.0 | 12 | 2125.0 | same-strand | Ribosomal Proteins L2, C-terminal domain |
5 | PF00181.25 | 1.0 | 12 | 2125.0 | same-strand | Ribosomal Proteins L2, RNA binding domain |