Result : EXP04169

Protein Information

• Protein name: EXP04169
• NCBI Accession ID: NZ_CP027540.1
• Organism: S. pneumoniae D39V
• Left: 185918
• Right: 185992
• Strand: +
• Nucleotide Sequence: CTGGTAAGTCCAGTGGACGTTTTTAGCCTGACGCTAAAAATAAAAACCGTCAGTAAGTTCGGGGGACGTTTTTAG
• Sequence: LVSPVDVFSLTLKIKTVSKFGGRF
• Source of smORF: Ribo-seq
• Pubmed ID: 35852327
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 24

Conservation Analysis

No. of Species: 2

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	1768323	1768385	-	NZ_LR134336.1	Streptococcus oralis ATCC 35037
2	649604	649690	+	NZ_CP032620.1	Streptococcus koreensis

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NZ_LR134336.1

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF13091.8	1.0	2	2343.0	same-strand	PLD-like domain
2	PF00614.24	1.0	2	2343.0	same-strand	Phospholipase D Active site motif
3	PF13396.8	1.0	2	2343.0	same-strand	Phospholipase D-nuclease N-terminal
4	PF12182.10	1.0	2	1543.5	same-strand	Bacterial lipoprotein
5	PF08245.14	1.0	2	188.0	same-strand	Mur ligase middle domain
6	PF06949.13	1.0	2	79.5	same-strand	Protein of unknown function (DUF1292)
7	PF03652.17	1.0	2	404.5	same-strand	Holliday junction resolvase
8	PF06135.14	1.0	2	825.5	same-strand	IreB regulatory phosphoprotein