Result : EXP04158
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP04158 |
| NCBI Accession ID | NZ_CP027540.1 |
| Organism | S. pneumoniae D39V |
| Left | 86107 |
| Right | 86193 |
| Strand | + |
| Nucleotide Sequence | ATGAAGCTCGTCAACAGGTGTCTTATGACAAGTAACCTTGGCTGTTTAGGCGAAGGGCATCTGCACGAATCAGGGCTTTCTAAGTGA |
| Sequence | MKLVNRCLMTSNLGCLGEGHLHESGLSK |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 35852327 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 28 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1963534 | 1963620 | - | NZ_LS483383.1 | Streptococcus cristatus ATCC 51100 |
| 2 | 84330 | 84416 | + | NZ_LR134336.1 | Streptococcus oralis ATCC 35037 |
| 3 | 145029 | 145115 | + | NC_015875.1 | Streptococcus pseudopneumoniae IS7493 |
| 4 | 1694943 | 1695029 | - | NZ_CP032621.1 | Streptococcus gwangjuense |
| 5 | 1314890 | 1314976 | - | NZ_LR134275.1 | Streptococcus vestibularis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LR134336.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00163.21 | 1.0 | 5 | 43 | same-strand | Ribosomal protein S4/S9 N-terminal domain |
| 2 | PF01479.27 | 0.8 | 4 | 43.0 | same-strand | S4 domain |
| 3 | PF11966.10 | 0.6 | 3 | 1884 | same-strand | SSURE domain |
| 4 | PF04650.19 | 0.6 | 3 | 1884 | same-strand | YSIRK type signal peptide |
| 5 | PF00746.23 | 0.6 | 3 | 1884 | same-strand | LPXTG cell wall anchor motif |
| 6 | PF00072.26 | 0.6 | 3 | 1105 | same-strand | Response regulator receiver domain |
| 7 | PF00486.30 | 0.6 | 3 | 1105 | same-strand | Transcriptional regulatory protein, C terminal |
| 8 | PF02518.28 | 0.6 | 3 | 66 | same-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
| 9 | PF00512.27 | 0.6 | 3 | 66 | same-strand | His Kinase A (phospho-acceptor) domain |
| 10 | PF00672.27 | 0.6 | 3 | 66 | same-strand | HAMP domain |
++ More..