Result : EXP04155
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP04155 |
| NCBI Accession ID | NZ_CP027540.1 |
| Organism | S. pneumoniae D39V |
| Left | 39961 |
| Right | 39996 |
| Strand | + |
| Nucleotide Sequence | ATGAATCGTAATTTAGAACGGTGTTATCTATTCTGA |
| Sequence | MNRNLERCYLF |
| Source of smORF | Ribo-seq |
| Function | The given small ORF when mutated reduces the ability of the bacteria to colonise nasopharynx in mice. Pubmed:35852327 |
| Pubmed ID | 35852327 |
| Domain | |
| Functional Category | Manually curated function from literature |
| Uniprot ID | |
| ORF Length (Amino Acid) | 11 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1758863 | 1758898 | - | NZ_CP032621.1 | Streptococcus gwangjuense |
| 2 | 92326 | 92361 | + | NC_015875.1 | Streptococcus pseudopneumoniae IS7493 |
| 3 | 99115 | 99150 | + | NC_015875.1 | Streptococcus pseudopneumoniae IS7493 |
++ More..