Protein name |
EXP04109 |
NCBI Accession ID |
|
Organism |
|
Left |
|
Right |
|
Strand |
|
Nucleotide Sequence |
ATGGCAGTACCTAAGAAAAGAACTTCTAAAGCAAAAAGAAATATGAGAAGATCACATGATTCAATTAAAGCTCCAAATATTATTGTAGAAGCTGATGGATCAATAAGAAGACCACACAGATTAAACTTAGAAACAGGAGTTTAG |
Sequence |
MAVPKKRTSKAKRNMRRSHDSIKAPNIIVEADGSIRRPHRLNLETGV |
Source of smORF |
Metagenomic Ribo-seq |
Function |
The ORF matches to the profile of cl09115. Profile Description: Ribosomal L32p protein family. This protein describes bacterial ribosomal protein L32. The noise cutoff is set low enough to include the equivalent protein from mitochondria and chloroplasts. No related proteins from the Archaea nor from the eukaryotic cytosol are detected by this model. This model is a fragment model; the putative L32 of some species shows similarity only toward the N-terminus. [Protein synthesis, Ribosomal proteins: synthesis and modification] |
Pubmed ID |
32601270
|
Domain |
CDD:415589 |
Functional Category |
Conserved domain based functional assignment |
Uniprot ID |
|
ORF Length (Amino Acid) |
47 |