Result : EXP03960
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP03960 |
| NCBI Accession ID | |
| Organism | Propionibacterium,Stomatobaculum,Dorea |
| Left | |
| Right | |
| Strand | |
| Nucleotide Sequence | ATGAGAAATAAAGGCAGGAGGGCACTGCAGATCCTACTGCTGTCCCTGTCGGTCTGCTTCCTCGTCTACGGATATTTCCGNGGGGAAGCGCCGATTGTCCTGAATAAGGCCGTCAATATCTGTCTGGAATGCATCGGACTGGGATGA |
| Sequence | MRNKGRRALQILLLSLSVCFLVYGYFXGEAPIVLNKAVNICLECIGLG |
| Source of smORF | Metagenomic Ribo-seq |
| Function | |
| Pubmed ID | 32601270 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 48 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 350311 | 350448 | - | NZ_LT635772.1 | Anaerococcus mediterraneensis |
| 2 | 1429949 | 1430113 | + | NZ_LT821227.1 | Phoenicibacter congonensis |
| 3 | 851947 | 852099 | - | NZ_LT635475.1 | Ezakiella massiliensis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LT635772.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF08534.12 | 1.0 | 3 | 559.5 | same-strand | Redoxin |
| 2 | PF00578.23 | 1.0 | 3 | 559.5 | same-strand | AhpC/TSA family |
| 3 | PF13905.8 | 1.0 | 3 | 263 | same-strand | Thioredoxin-like |
| 4 | PF12838.9 | 1.0 | 3 | 94.0 | same-strand | 4Fe-4S dicluster domain |
| 5 | PF13187.8 | 0.67 | 2 | 183 | same-strand | 4Fe-4S dicluster domain |
| 6 | PF13237.8 | 0.67 | 2 | 2570.0 | both-strands | 4Fe-4S dicluster domain |
| 7 | PF02518.28 | 0.67 | 2 | 899.0 | same-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
| 8 | PF00512.27 | 0.67 | 2 | 899.0 | same-strand | His Kinase A (phospho-acceptor) domain |
| 9 | PF00072.26 | 0.67 | 2 | 1120.5 | same-strand | Response regulator receiver domain |
| 10 | PF00486.30 | 0.67 | 2 | 1120.5 | same-strand | Transcriptional regulatory protein, C terminal |
++ More..