| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP03906 |
| NCBI Accession ID | |
| Organism | Eubacterium,Neglecta,Dielma |
| Left | |
| Right | |
| Strand | |
| Nucleotide Sequence | ATGACGGAAAAGAAACGGCGGCGCATTGGCATCGCCTGCCTTGTCCTGGGCCTGGCATTCGTCGGGTTCGGACTTCTGCGGGAGGAGCACCTGACTGTGCTCAAAAAGGCGGCGGCCATCTGCTTGGAATGTATCGGTATCGGTTAA |
| Sequence | MTEKKRRRIGIACLVLGLAFVGFGLLREEHLTVLKKAAAICLECIGIG |
| Source of smORF | Metagenomic Ribo-seq |
| Function | |
| Pubmed ID | 32601270 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 48 |
| Conservation Analysis |
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 26263 | 26385 | + | NC_013895.2 | Mageeibacillus indolicus UPII9-5 |
| 2 | 350311 | 350448 | - | NZ_LT635772.1 | Anaerococcus mediterraneensis |
| 3 | 20726 | 20878 | - | NZ_CP031518.1 | Treponema ruminis |
| 4 | 2090279 | 2090425 | - | NC_015385.1 | Treponema succinifaciens DSM 2489 |
| 5 | 868114 | 868257 | + | NC_009922.1 | Alkaliphilus oremlandii OhILAs |
| 6 | 1635433 | 1635558 | - | NZ_AP019367.1 | Parolsenella catena |
| 7 | 4562046 | 4562192 | - | NZ_CP039126.1 | Blautia producta |
| 8 | 1599700 | 1599831 | - | NZ_CP034413.2 | Dysosmobacter welbionis |
| 9 | 782234 | 782371 | - | NZ_CP007453.1 | Peptoclostridium acidaminophilum DSM 3953 |
| Neighborhood Conservation Analysis |
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00578.23 | 0.89 | 8 | 489.5 | same-strand | AhpC/TSA family |
| 2 | PF13905.8 | 1.0 | 9 | 123 | same-strand | Thioredoxin-like |
| 3 | PF12801.9 | 0.89 | 8 | -7.0 | same-strand | 4Fe-4S binding domain |
| 4 | PF08534.12 | 0.89 | 8 | 435.5 | same-strand | Redoxin |