Result : EXP03873
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP03873 |
| NCBI Accession ID | |
| Organism | Leptotrichia |
| Left | |
| Right | |
| Strand | |
| Nucleotide Sequence | ATGCTCGTTTCGGCAGAACTATCAGAAATAATGGCATTAAGTGACAGAATTGCAGTAATGTATTCGGGAAGAATTGTAGGGGTTTTGGATAGAAAAGATGCAACAACAGAAAAAATAGGAATATTAATGGCAGGAGGGAAAATAGATGATTAA |
| Sequence | MLVSAELSEIMALSDRIAVMYSGRIVGVLDRKDATTEKIGILMAGGKIDD |
| Source of smORF | Metagenomic Ribo-seq |
| Function | |
| Pubmed ID | 32601270 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 50 |
++ More..
| Conservation Analysis |
No. of Species: 378
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 593006 | 593158 | + | NZ_AP019846.1 | Leptotrichia hongkongensis |
| 2 | 1871009 | 1871161 | - | NZ_AP019845.1 | Leptotrichia trevisanii |
| 3 | 650541 | 650693 | + | NZ_AP019827.1 | Leptotrichia shahii |
| 4 | 669900 | 670052 | + | NC_013192.1 | Leptotrichia buccalis C-1013-b |
| 5 | 622819 | 622971 | + | NZ_AP019829.2 | Leptotrichia wadei |
| 6 | 1342291 | 1342443 | - | NZ_AP019822.1 | Pseudoleptotrichia goodfellowii |
| 7 | 585055 | 585177 | + | NC_013515.1 | Streptobacillus moniliformis DSM 12112 |
| 8 | 491253 | 491402 | + | NC_014632.1 | Ilyobacter polytropus DSM 2926 |
| 9 | 145463 | 145609 | - | NC_014632.1 | Ilyobacter polytropus DSM 2926 |
| 10 | 4943458 | 4943631 | + | NZ_CP009933.1 | Clostridium scatologenes |
| 11 | 4190647 | 4190820 | - | NZ_CP011803.1 | Clostridium carboxidivorans P7 |
| 12 | 885041 | 885211 | + | NZ_CP026363.1 | Brevibacillus agri |
| 13 | 230391 | 230540 | + | NZ_LT906477.1 | Clostridium cochlearium |
| 14 | 4966639 | 4966812 | - | NZ_CP020953.1 | Clostridium drakei |
| 15 | 4619301 | 4619477 | - | NC_014306.1 | Erwinia billingiae Eb661 |
| 16 | 607117 | 607263 | - | NZ_CP068983.1 | Paradevosia shaoguanensis |
| 17 | 2869269 | 2869427 | + | NZ_CP014136.1 | Gibbsiella quercinecans |
| 18 | 3481626 | 3481751 | - | NZ_CP016020.1 | Bacillus weihaiensis |
| 19 | 6245399 | 6245569 | - | NZ_LR134338.1 | Brevibacillus brevis |
| 20 | 2509296 | 2509448 | + | NZ_LR134338.1 | Brevibacillus brevis |
| 21 | 896773 | 896919 | + | NZ_CP041690.1 | Youhaiella tibetensis |
| 22 | 126522 | 126674 | - | NZ_CP041690.1 | Youhaiella tibetensis |
| 23 | 1065708 | 1065866 | + | NC_017079.1 | Caldilinea aerophila DSM 14535 = NBRC 104270 |
| 24 | 716011 | 716139 | + | NC_019978.1 | Halobacteroides halobius DSM 5150 |
| 25 | 584347 | 584496 | + | NC_016584.1 | Desulfosporosinus orientis DSM 765 |
| 26 | 2464831 | 2464995 | + | NZ_AP018437.1 | Pelolinea submarina |
| 27 | 1985271 | 1985420 | - | NZ_CP016809.1 | Paenibacillus ihbetae |
| 28 | 1457549 | 1457686 | + | NZ_CP009687.1 | Clostridium aceticum |
| 29 | 1369148 | 1369294 | - | NC_014364.1 | Sediminispirochaeta smaragdinae DSM 11293 |
| 30 | 1535842 | 1535982 | + | NZ_CP020559.1 | Clostridium formicaceticum |
| 31 | 2438754 | 2438879 | - | NC_009437.1 | Caldicellulosiruptor saccharolyticus DSM 8903 |
| 32 | 2650973 | 2651113 | - | NC_009437.1 | Caldicellulosiruptor saccharolyticus DSM 8903 |
| 33 | 1833234 | 1833359 | - | NZ_CP034791.1 | Caldicellulosiruptor changbaiensis |
| 34 | 1589381 | 1589536 | - | NC_014657.1 | Caldicellulosiruptor owensensis OL |
| 35 | 2009346 | 2009483 | - | NC_015555.1 | Thermoanaerobacterium xylanolyticum LX-11 |
| 36 | 961728 | 961853 | + | NC_014721.1 | Caldicellulosiruptor kristjanssonii I77R1B |
| 37 | 2523733 | 2523873 | - | NC_014721.1 | Caldicellulosiruptor kristjanssonii I77R1B |
| 38 | 1593824 | 1593973 | - | NZ_CP010822.1 | Thermus aquaticus Y51MC23 |
| 39 | 1854408 | 1854533 | - | NC_012034.1 | Caldicellulosiruptor bescii DSM 6725 |
| 40 | 130549 | 130689 | + | NC_012034.1 | Caldicellulosiruptor bescii DSM 6725 |
| 41 | 1112910 | 1113035 | + | NC_014720.1 | Caldicellulosiruptor kronotskyensis 2002 |
| 42 | 202698 | 202838 | + | NC_014720.1 | Caldicellulosiruptor kronotskyensis 2002 |
| 43 | 887606 | 887773 | + | NC_014393.1 | Clostridium cellulovorans 743B |
| 44 | 437812 | 437952 | + | NZ_CP009170.1 | Thermoanaerobacter kivui |
| 45 | 2236338 | 2236475 | - | NC_014410.1 | Thermoanaerobacterium thermosaccharolyticum DSM 571 |
| 46 | 1870374 | 1870514 | - | NC_014964.1 | Thermoanaerobacter brockii subsp. finnii Ako-1 |
| 47 | 544197 | 544334 | + | NZ_CP047602.1 | Thermoanaerobacterium aotearoense |
| 48 | 838172 | 838345 | + | NZ_CP006577.1 | Archaeoglobus fulgidus DSM 8774 |
| 49 | 601617 | 601739 | + | NC_013522.1 | Thermanaerovibrio acidaminovorans DSM 6589 |
| 50 | 608347 | 608469 | - | NC_019695.1 | Chroococcidiopsis thermalis PCC 7203 |
| 51 | 1081106 | 1081240 | + | NZ_AP014510.1 | Thermotoga profunda AZM34c06 |
| 52 | 2204403 | 2204537 | + | NZ_CP043611.1 | Paenibacillus antarcticus |
| 53 | 1699269 | 1699424 | - | NC_014392.1 | Caldicellulosiruptor obsidiansis OB47 |
| 54 | 472770 | 472910 | + | NC_003869.1 | Caldanaerobacter subterraneus subsp. tengcongensis MB4 |
| 55 | 539369 | 539509 | + | NC_015958.1 | Thermoanaerobacter wiegelii Rt8.B1 |
| 56 | 1003435 | 1003590 | + | NC_014652.1 | Caldicellulosiruptor hydrothermalis 108 |
| 57 | 1461332 | 1461493 | - | NZ_CP034118.1 | Staphylospora marina |
| 58 | 784916 | 785077 | - | NC_016633.1 | Sphaerochaeta pleomorpha str. Grapes |
| 59 | 1512322 | 1512480 | + | NC_016633.1 | Sphaerochaeta pleomorpha str. Grapes |
| 60 | 18091 | 18240 | + | NC_016633.1 | Sphaerochaeta pleomorpha str. Grapes |
| 61 | 1746672 | 1746818 | + | NZ_CP015378.1 | Fictibacillus phosphorivorans |
| 62 | 477728 | 477868 | + | NC_013921.1 | Thermoanaerobacter italicus Ab9 |
| 63 | 544830 | 544970 | + | NC_014209.1 | Thermoanaerobacter mathranii subsp. mathranii str. A3 |
| 64 | 1529236 | 1529397 | - | NZ_CP040676.1 | Exiguobacterium mexicanum |
| 65 | 1738865 | 1739014 | + | NZ_CP020715.1 | Cnuibacter physcomitrellae |
| 66 | 1096235 | 1096372 | + | NZ_HG917868.1 | Clostridium bornimense |
| 67 | 657766 | 657921 | + | NZ_CP016379.1 | Anoxybacter fermentans |
| 68 | 942348 | 942497 | - | NZ_CP014141.1 | Thermus parvatiensis |
| 69 | 395912 | 396061 | - | NZ_LT906450.1 | Rhodococcus rhodochrous |
| 70 | 3357470 | 3357622 | - | NZ_CP024785.1 | Nostoc flagelliforme CCNUN1 |
| 71 | 1123087 | 1123254 | + | NZ_CP012152.1 | Anoxybacillus gonensis |
| 72 | 1079580 | 1079741 | + | NC_009828.1 | Pseudothermotoga lettingae TMO |
| 73 | 1074286 | 1074447 | + | NC_022792.1 | Pseudothermotoga elfii DSM 9442 = NBRC 107921 |
| 74 | 2098035 | 2098163 | + | NC_014212.1 | Meiothermus silvanus DSM 9946 |
| 75 | 1084160 | 1084309 | + | NZ_CP038452.1 | Thermus caldilimi |
| 76 | 2704780 | 2704917 | - | NZ_CP070511.1 | Parageobacillus toebii |
| 77 | 1518060 | 1518197 | + | NZ_CP015438.1 | Anoxybacillus amylolyticus |
| 78 | 704860 | 704994 | + | NZ_CP064060.1 | Anoxybacillus caldiproteolyticus |
| 79 | 2067717 | 2067884 | - | NZ_CP014342.1 | Geobacillus subterraneus |
| 80 | 3217395 | 3217517 | - | NZ_CP014150.1 | Paeniclostridium sordellii |
| 81 | 985627 | 985758 | - | NC_014376.1 | [Clostridium] saccharolyticum WM1 |
| 82 | 4535150 | 4535302 | + | NZ_CP047242.1 | Trichormus variabilis 0441 |
| 83 | 193570 | 193692 | - | NC_019751.1 | Calothrix sp. PCC 6303 |
| 84 | 1941456 | 1941590 | - | NZ_CP048103.1 | Kroppenstedtia eburnea |
| 85 | 833854 | 833976 | + | NC_014761.1 | Oceanithermus profundus DSM 14977 |
| 86 | 125481 | 125630 | + | NC_014761.1 | Oceanithermus profundus DSM 14977 |
| 87 | 3882611 | 3882745 | + | NZ_CP034035.1 | Brenneria rubrifaciens |
| 88 | 3010125 | 3010247 | + | NZ_CP011058.1 | Paenibacillus beijingensis |
| 89 | 3264190 | 3264324 | + | NZ_CP011058.1 | Paenibacillus beijingensis |
| 90 | 1585761 | 1585904 | - | NZ_CP011058.1 | Paenibacillus beijingensis |
| 91 | 1882641 | 1882778 | - | NZ_LR699011.1 | Roseburia hominis |
| 92 | 3904221 | 3904358 | - | NZ_CP024035.1 | Priestia aryabhattai |
| 93 | 869332 | 869475 | - | NZ_CP017704.1 | Peribacillus simplex NBRC 15720 = DSM 1321 |
| 94 | 446180 | 446329 | + | NZ_CP016312.1 | Thermus brockianus |
| 95 | 1302572 | 1302706 | + | NC_006510.1 | Geobacillus kaustophilus HTA426 |
| 96 | 1908780 | 1908905 | - | NC_006510.1 | Geobacillus kaustophilus HTA426 |
| 97 | 388824 | 388958 | + | NZ_CP061470.1 | Geobacillus zalihae |
| 98 | 752301 | 752435 | + | NZ_CP061472.1 | Geobacillus thermoleovorans |
| 99 | 2680371 | 2680505 | - | NZ_CP018058.1 | Geobacillus thermocatenulatus |
| 100 | 1795675 | 1795803 | - | NC_016148.1 | Thermovirga lienii DSM 17291 |
| 101 | 3125394 | 3125540 | + | NZ_CP058322.1 | Micromonospora carbonacea |
| 102 | 3626128 | 3626298 | + | NZ_CP058322.1 | Micromonospora carbonacea |
| 103 | 1887357 | 1887494 | + | NZ_CP016622.1 | Parageobacillus thermoglucosidasius |
| 104 | 5859171 | 5859317 | - | NC_010628.1 | Nostoc punctiforme PCC 73102 |
| 105 | 327211 | 327375 | + | NC_014960.1 | Anaerolinea thermophila UNI-1 |
| 106 | 514396 | 514536 | + | NC_017583.1 | Spirochaeta thermophila DSM 6578 |
| 107 | 739605 | 739730 | + | NZ_CP009761.1 | Parvimonas micra |
| 108 | 4874404 | 4874547 | - | NZ_CP041305.1 | Cytobacillus ciccensis |
| 109 | 756473 | 756613 | + | NZ_CP030127.1 | Indioceanicola profundi |
| 110 | 1151063 | 1151236 | - | NZ_CP068053.1 | Peribacillus psychrosaccharolyticus |
| 111 | 2479621 | 2479797 | - | NZ_CP065425.1 | Heyndrickxia vini |
| 112 | 2035729 | 2035857 | - | NC_017455.1 | Halanaerobium praevalens DSM 2228 |
| 113 | 227728 | 227871 | + | NZ_CP009709.1 | Weizmannia coagulans DSM 1 = ATCC 7050 |
| 114 | 1009601 | 1009750 | - | NZ_CP014161.1 | Aerococcus urinae |
| 115 | 3000879 | 3001025 | - | NC_009253.1 | Desulfotomaculum reducens MI-1 |
| 116 | 6583937 | 6584107 | - | NZ_AP019400.1 | Cohnella abietis |
| 117 | 2371166 | 2371291 | + | NZ_CP034413.2 | Dysosmobacter welbionis |
| 118 | 594531 | 594689 | - | NC_015152.1 | Sphaerochaeta globosa str. Buddy |
| 119 | 3244800 | 3244961 | - | NC_015152.1 | Sphaerochaeta globosa str. Buddy |
| 120 | 1120483 | 1120608 | - | NZ_LR134524.1 | Peptoniphilus harei |
| 121 | 1626696 | 1626842 | - | NZ_CP035130.1 | Gudongella oleilytica |
| 122 | 2158554 | 2158727 | + | NZ_CP042593.1 | Bacillus dafuensis |
| 123 | 106660 | 106812 | + | NC_019793.1 | Deinococcus peraridilitoris DSM 19664 |
| 124 | 3700430 | 3700558 | - | NC_019793.1 | Deinococcus peraridilitoris DSM 19664 |
| 125 | 2764449 | 2764583 | + | NZ_CP034235.1 | Paenibacillus psychroresistens |
| 126 | 2849084 | 2849227 | - | NC_016627.1 | Acetivibrio clariflavus DSM 19732 |
| 127 | 1969899 | 1970030 | - | NC_016627.1 | Acetivibrio clariflavus DSM 19732 |
| 128 | 559563 | 559706 | - | NC_019386.1 | Thermus oshimai JL-2 |
| 129 | 1397917 | 1398063 | + | NZ_AP014924.1 | Limnochorda pilosa |
| 130 | 3524002 | 3524142 | - | NC_004193.1 | Oceanobacillus iheyensis HTE831 |
| 131 | 1509623 | 1509757 | - | NZ_CP027002.1 | [Ruminococcus] gnavus ATCC 29149 |
| 132 | 90920 | 91084 | + | NZ_CP012622.1 | Spiroplasma cantharicola |
| 133 | 2219995 | 2220120 | - | NZ_CP029494.1 | Deinococcus irradiatisoli |
| 134 | 1042887 | 1043024 | - | NZ_CP065061.1 | Streptococcus equi subsp. zooepidemicus |
| 135 | 1562395 | 1562520 | - | NZ_CP065061.1 | Streptococcus equi subsp. zooepidemicus |
| 136 | 973287 | 973409 | + | NC_015387.1 | Marinithermus hydrothermalis DSM 14884 |
| 137 | 1018235 | 1018372 | + | NZ_CP034234.1 | Erysipelothrix piscisicarius |
| 138 | 1702293 | 1702430 | - | NZ_LR134439.1 | Erysipelothrix rhusiopathiae |
| 139 | 4689186 | 4689320 | + | NZ_CP034036.1 | Brenneria nigrifluens DSM 30175 = ATCC 13028 |
| 140 | 4324076 | 4324219 | + | NZ_CP030926.1 | Peribacillus butanolivorans |
| 141 | 588095 | 588226 | + | NZ_CP068564.1 | Keratinibaculum paraultunense |
| 142 | 1857074 | 1857217 | + | NC_022524.1 | Bacillus infantis NRRL B-14911 |
| 143 | 2779366 | 2779500 | - | NZ_CP022413.2 | Blautia hansenii DSM 20583 |
| 144 | 976615 | 976740 | + | NC_010001.1 | Lachnoclostridium phytofermentans ISDg |
| 145 | 2022147 | 2022284 | + | NC_017672.3 | Paenibacillus mucilaginosus K02 |
| 146 | 1265997 | 1266146 | - | NZ_CP029491.1 | Streptococcus sobrinus |
| 147 | 2436552 | 2436725 | - | NC_011830.1 | Desulfitobacterium hafniense DCB-2 |
| 148 | 2232509 | 2232646 | - | NZ_CP012502.1 | Bacillus beveridgei |
| 149 | 1804879 | 1805022 | - | NC_018017.1 | Desulfitobacterium dehalogenans ATCC 51507 |
| 150 | 566613 | 566759 | + | NZ_CP017237.1 | Moorella thermoacetica |
| 151 | 44087 | 44251 | - | NC_013205.1 | Alicyclobacillus acidocaldarius subsp. acidocaldarius DSM 446 |
| 152 | 2478810 | 2478947 | + | NZ_CP070273.1 | Marinomonas foliarum |
| 153 | 2717035 | 2717181 | + | NZ_CP070273.1 | Marinomonas foliarum |
| 154 | 1647281 | 1647412 | - | NC_000854.2 | Aeropyrum pernix K1 |
| 155 | 325366 | 325500 | - | NZ_AP014640.1 | Leptolyngbya boryana IAM M-101 |
| 156 | 1910181 | 1910321 | - | NC_014387.1 | Butyrivibrio proteoclasticus B316 |
| 157 | 1580957 | 1581091 | + | NZ_AP019309.1 | Intestinibaculum porci |
| 158 | 3601509 | 3601673 | - | NZ_CP054301.1 | Marinomonas primoryensis |
| 159 | 1651065 | 1651199 | - | NC_016630.1 | Filifactor alocis ATCC 35896 |
| 160 | 778325 | 778471 | - | NC_022795.1 | Pseudothermotoga hypogea DSM 11164 = NBRC 106472 |
| 161 | 3853678 | 3853818 | - | NC_011831.1 | Chloroflexus aggregans DSM 9485 |
| 162 | 1629524 | 1629694 | + | NZ_CP009416.1 | Jeotgalibacillus malaysiensis |
| 163 | 3091791 | 3091937 | - | NZ_CP016076.1 | Actinoalloteichus fjordicus |
| 164 | 7493945 | 7494091 | - | NZ_CP015163.1 | Amycolatopsis albispora |
| 165 | 1478707 | 1478835 | - | NZ_CP009896.1 | Pimelobacter simplex |
| 166 | 647492 | 647653 | + | NZ_CP009896.1 | Pimelobacter simplex |
| 167 | 1100150 | 1100311 | - | NC_016048.1 | Oscillibacter valericigenes Sjm18-20 |
| 168 | 2686933 | 2687091 | - | NZ_CP007128.1 | Gemmatirosa kalamazoonesis |
| 169 | 1160109 | 1160246 | - | NZ_LR594046.1 | Streptococcus dysgalactiae |
| 170 | 2938370 | 2938516 | - | NZ_CP022521.1 | Actinoalloteichus hoggarensis |
| 171 | 513211 | 513345 | + | NC_015559.1 | Marinomonas posidonica IVIA-Po-181 |
| 172 | 639568 | 639711 | + | NZ_CP039965.1 | Pseudorhodobacter turbinis |
| 173 | 3331583 | 3331708 | - | NC_002678.2 | Mesorhizobium japonicum MAFF 303099 |
| 174 | 2527252 | 2527407 | + | NC_002678.2 | Mesorhizobium japonicum MAFF 303099 |
| 175 | 126214 | 126354 | - | NZ_LR134512.1 | Streptococcus agalactiae |
| 176 | 841280 | 841402 | + | NZ_CP061081.1 | Marinomonas arctica |
| 177 | 1200569 | 1200742 | + | NC_019973.1 | Mesorhizobium australicum WSM2073 |
| 178 | 1893999 | 1894154 | - | NC_019973.1 | Mesorhizobium australicum WSM2073 |
| 179 | 215960 | 216109 | - | NZ_CP023643.1 | Brochothrix thermosphacta |
| 180 | 3576797 | 3576934 | + | NZ_CP013984.1 | Bacillus inaquosorum |
| 181 | 1327637 | 1327780 | + | NZ_LR134483.1 | Listeria grayi |
| 182 | 3545833 | 3545997 | + | NZ_CP021434.1 | Tumebacillus avium |
| 183 | 2527445 | 2527609 | - | NZ_CP024109.1 | Bacillus cytotoxicus |
| 184 | 400514 | 400675 | + | NC_013791.2 | Alkalihalobacillus pseudofirmus OF4 |
| 185 | 1140389 | 1140565 | + | NZ_CP033507.1 | Mesorhizobium jarvisii |
| 186 | 1875301 | 1875456 | - | NZ_CP033507.1 | Mesorhizobium jarvisii |
| 187 | 1290180 | 1290329 | - | NZ_CP031733.1 | Streptococcus chenjunshii |
| 188 | 1010748 | 1010909 | - | NZ_CP014699.1 | Streptococcus pantholopis |
| 189 | 374630 | 374791 | + | NZ_LS991421.1 | Lacticaseibacillus zeae |
| 190 | 966161 | 966286 | + | NZ_LS483476.1 | Lederbergia lentus |
| 191 | 2291381 | 2291539 | - | NZ_CP003984.1 | Planktomarina temperata RCA23 |
| 192 | 2746584 | 2746751 | - | NZ_CP033433.1 | Cohnella candidum |
| 193 | 2447818 | 2447946 | - | NZ_CP033433.1 | Cohnella candidum |
| 194 | 3597028 | 3597183 | + | NZ_LT603683.1 | Bacillus glycinifermentans |
| 195 | 1830706 | 1830873 | - | NZ_CP043405.1 | Streptococcus ratti |
| 196 | 3601568 | 3601738 | - | NC_007530.2 | Bacillus anthracis str. 'Ames Ancestor' |
| 197 | 1010627 | 1010776 | + | NZ_CP031700.1 | Neisseria zalophi |
| 198 | 1169401 | 1169577 | + | NZ_CP033361.1 | Mesorhizobium erdmanii |
| 199 | 1965771 | 1965926 | - | NZ_CP033361.1 | Mesorhizobium erdmanii |
| 200 | 304143 | 304286 | + | NC_011297.1 | Dictyoglomus thermophilum H-6-12 |
| 201 | 1202417 | 1202557 | + | NZ_CP048436.1 | Flavonifractor plautii |
| 202 | 800973 | 801110 | - | NZ_CP025257.1 | Mesoplasma syrphidae |
| 203 | 3534562 | 3534702 | - | NZ_CP014167.1 | Paenibacillus yonginensis |
| 204 | 673585 | 673713 | - | NZ_CP011454.1 | Gemmatimonas phototrophica |
| 205 | 2813516 | 2813668 | + | NZ_CP043043.1 | Gluconobacter thailandicus |
| 206 | 634138 | 634266 | - | NC_015578.1 | Treponema primitia ZAS-2 |
| 207 | 882251 | 882379 | - | NZ_CP013011.1 | Pyrodictium delaneyi |
| 208 | 1458871 | 1459041 | - | NC_014654.1 | Halanaerobium hydrogeniformans |
| 209 | 967572 | 967736 | + | NZ_CP035492.1 | Paenibacillus protaetiae |
| 210 | 259199 | 259336 | - | NZ_LR134341.1 | Streptococcus pseudoporcinus |
| 211 | 917363 | 917500 | + | NZ_LR594050.1 | Streptococcus porcinus |
| 212 | 1777223 | 1777372 | + | NZ_CP050296.1 | Mesorhizobium huakuii |
| 213 | 2760165 | 2760335 | + | NZ_CP016502.1 | Acetivibrio thermocellus DSM 2360 |
| 214 | 1644144 | 1644299 | - | NZ_CP026923.1 | Pontimonas salivibrio |
| 215 | 3759890 | 3760048 | + | NZ_CP015880.1 | Ensifer adhaerens |
| 216 | 2936782 | 2936907 | - | NZ_AP022871.1 | Phytohabitans suffuscus |
| 217 | 318111 | 318233 | - | NC_017243.1 | Brachyspira intermedia PWS/A |
| 218 | 1717900 | 1718046 | + | NZ_AP019551.1 | Athalassotoga saccharophila |
| 219 | 1547666 | 1547788 | + | NZ_CP046932.1 | Brachyspira hyodysenteriae |
| 220 | 1464762 | 1464899 | + | NZ_CP004078.1 | Paenibacillus sabinae T27 |
| 221 | 1641593 | 1641748 | - | NZ_CP061498.1 | Roseicitreum antarcticum |
| 222 | 4063878 | 4064042 | + | NZ_CP015064.1 | Mesorhizobium ciceri biovar biserrulae |
| 223 | 5211476 | 5211628 | + | NZ_CP015064.1 | Mesorhizobium ciceri biovar biserrulae |
| 224 | 4299051 | 4299173 | + | NZ_CP054614.1 | Paenibacillus barcinonensis |
| 225 | 2945485 | 2945616 | + | NC_009664.2 | Kineococcus radiotolerans SRS30216 = ATCC BAA-149 |
| 226 | 1347435 | 1347572 | + | NZ_CP036150.1 | Oceanispirochaeta crateris |
| 227 | 3810401 | 3810571 | - | NZ_CP032365.1 | Bacillus wiedmannii |
| 228 | 2968230 | 2968373 | - | NZ_AP021853.1 | Sporolactobacillus terrae |
| 229 | 16684 | 16854 | - | NC_014961.1 | Desulfurococcus mucosus DSM 2162 |
| 230 | 1435919 | 1436053 | + | NZ_CP020470.1 | Rhodobacter blasticus |
| 231 | 1178866 | 1179042 | + | NC_017310.1 | Desulfovibrio vulgaris RCH1 |
| 232 | 1794479 | 1794613 | - | NZ_CP030777.1 | Faecalibacterium prausnitzii |
| 233 | 884222 | 884371 | - | NZ_CP007493.1 | Thermofilum adornatus 1505 |
| 234 | 746119 | 746271 | + | NZ_CP021081.1 | Deinococcus ficus |
| 235 | 905193 | 905330 | - | NZ_CP010450.1 | Streptococcus pyogenes |
| 236 | 1415516 | 1415653 | + | NZ_CP009428.1 | Paenibacillus odorifer |
| 237 | 1271436 | 1271606 | + | NC_021921.1 | Halorhabdus tiamatea SARL4B |
| 238 | 1685944 | 1686081 | - | NZ_LR134293.1 | Streptococcus canis |
| 239 | 1730471 | 1730638 | + | NZ_CP009285.1 | Paenibacillus borealis |
| 240 | 1817430 | 1817567 | - | NZ_CP060715.1 | Erysipelothrix inopinata |
| 241 | 1173162 | 1173338 | + | NC_015675.1 | Mesorhizobium opportunistum WSM2075 |
| 242 | 1908542 | 1908694 | - | NC_015675.1 | Mesorhizobium opportunistum WSM2075 |
| 243 | 3551686 | 3551823 | + | NZ_CP048429.1 | Paenibacillus jilunlii |
| 244 | 3601823 | 3601990 | + | NZ_CP048429.1 | Paenibacillus jilunlii |
| 245 | 1647341 | 1647478 | + | NZ_CP009287.1 | Paenibacillus graminis |
| 246 | 1697418 | 1697582 | + | NZ_CP009287.1 | Paenibacillus graminis |
| 247 | 3516627 | 3516764 | + | NZ_CP068595.1 | Paenibacillus sonchi |
| 248 | 3566307 | 3566471 | + | NZ_CP068595.1 | Paenibacillus sonchi |
| 249 | 1791170 | 1791307 | + | NZ_LN831776.1 | Paenibacillus riograndensis SBR5 |
| 250 | 1842613 | 1842777 | + | NZ_LN831776.1 | Paenibacillus riograndensis SBR5 |
| 251 | 8575690 | 8575848 | - | NZ_CP022088.2 | Nocardia brasiliensis |
| 252 | 352526 | 352660 | + | NC_014334.2 | Lacticaseibacillus paracasei |
| 253 | 21338 | 21469 | + | NZ_CP024965.1 | Entomoplasma somnilux |
| 254 | 1068266 | 1068394 | - | NC_015680.1 | Pyrococcus yayanosii CH1 |
| 255 | 2405292 | 2405426 | + | NC_014150.1 | Brachyspira murdochii DSM 12563 |
| 256 | 1131035 | 1131157 | - | NC_014150.1 | Brachyspira murdochii DSM 12563 |
| 257 | 1955081 | 1955215 | + | NC_021181.2 | Lactobacillus acidophilus La-14 |
| 258 | 1371438 | 1371560 | - | NC_006177.1 | Symbiobacterium thermophilum IAM 14863 |
| 259 | 135279 | 135410 | - | NC_020560.1 | Sinorhizobium meliloti 2011 |
| 260 | 1517468 | 1517599 | + | NZ_CP039126.1 | Blautia producta |
| 261 | 2093738 | 2093872 | + | NC_017668.1 | Halobacillus halophilus DSM 2266 |
| 262 | 724484 | 724633 | + | NZ_LT960614.1 | Hartmannibacter diazotrophicus |
| 263 | 1497065 | 1497199 | + | NC_015500.1 | Treponema brennaborense DSM 12168 |
| 264 | 2090704 | 2090850 | + | NZ_CP019239.1 | Rhodoferax saidenbachensis |
| 265 | 1493307 | 1493474 | + | NZ_CP035108.1 | Geovibrio thiophilus |
| 266 | 1851633 | 1851797 | + | NZ_CP035108.1 | Geovibrio thiophilus |
| 267 | 5052337 | 5052486 | - | NZ_AP021876.1 | Desulfosarcina ovata subsp. sediminis |
| 268 | 990858 | 991034 | + | NZ_CP039292.1 | Actinomyces procaprae |
| 269 | 3461872 | 3462018 | - | NZ_CP017940.1 | Phyllobacterium zundukense |
| 270 | 358714 | 358860 | + | NZ_CP022535.1 | Spiroplasma corruscae |
| 271 | 1683055 | 1683177 | - | NZ_CP032364.1 | Lachnoanaerobaculum umeaense |
| 272 | 6239898 | 6240035 | + | NC_010162.1 | Sorangium cellulosum So ce56 |
| 273 | 1602493 | 1602660 | + | NC_014011.1 | Aminobacterium colombiense DSM 12261 |
| 274 | 1579256 | 1579411 | + | NC_014831.1 | Thermaerobacter marianensis DSM 12885 |
| 275 | 2175222 | 2175383 | - | NZ_CP025066.1 | Halalkaliarchaeum desulfuricum |
| 276 | 22319 | 22456 | + | NC_011961.1 | Thermomicrobium roseum DSM 5159 |
| 277 | 650045 | 650173 | - | NZ_CP019937.1 | Ketogulonicigenium robustum |
| 278 | 3106775 | 3106921 | + | NZ_CP039731.1 | Aquitalea aquatilis |
| 279 | 4701980 | 4702150 | - | NZ_CP043998.1 | Clostridium diolis |
| 280 | 1976577 | 1976699 | + | NC_014330.1 | Brachyspira pilosicoli 95/1000 |
| 281 | 3289472 | 3289600 | - | NC_018068.1 | Desulfosporosinus acidiphilus SJ4 |
| 282 | 463233 | 463382 | + | NZ_LT635772.1 | Anaerococcus mediterraneensis |
| 283 | 3295998 | 3296144 | + | NZ_CP035807.1 | Thiospirochaeta perfilievii |
| 284 | 475489 | 475635 | + | NZ_CP017707.1 | Chromobacterium vaccinii |
| 285 | 2534545 | 2534691 | + | NC_005085.1 | Chromobacterium violaceum ATCC 12472 |
| 286 | 2364427 | 2364561 | - | NZ_CP020772.1 | Halobacillus mangrovi |
| 287 | 1382888 | 1383010 | + | NZ_CP019914.1 | Brachyspira hampsonii |
| 288 | 71104 | 71232 | - | NZ_CP045201.1 | Pseudopuniceibacterium antarcticum |
| 289 | 1410863 | 1410997 | + | NZ_AP024085.1 | Faecalibacillus intestinalis |
| 290 | 777717 | 777884 | - | NZ_CP035485.1 | Salicibibacter halophilus |
| 291 | 464573 | 464701 | - | NC_020908.1 | Octadecabacter arcticus 238 |
| 292 | 1504365 | 1504508 | - | NC_000961.1 | Pyrococcus horikoshii OT3 |
| 293 | 1071089 | 1071223 | + | NZ_CP068170.1 | Erysipelatoclostridium ramosum |
| 294 | 1774968 | 1775102 | + | NZ_CP029797.1 | Paraliobacillus zengyii |
| 295 | 1853244 | 1853408 | + | NZ_CP029797.1 | Paraliobacillus zengyii |
| 296 | 20709 | 20855 | - | NZ_CP019938.1 | Ketogulonicigenium robustum |
| 297 | 4035277 | 4035405 | + | NC_020911.1 | Octadecabacter antarcticus 307 |
| 298 | 273663 | 273812 | + | NZ_LT907975.1 | Pseudodesulfovibrio profundus |
| 299 | 548904 | 549035 | + | NZ_AP023367.1 | Anaerocolumna cellulosilytica |
| 300 | 2829495 | 2829668 | + | NZ_CP049037.1 | Pseudohalocynthiibacter aestuariivivens |
| 301 | 545141 | 545275 | + | NC_015276.1 | Marinomonas mediterranea MMB-1 |
| 302 | 1773180 | 1773329 | - | NZ_CP022196.1 | Celeribacter ethanolicus |
| 303 | 960113 | 960274 | - | NZ_CP049253.1 | Microbacterium amylolyticum |
| 304 | 3929611 | 3929763 | + | NZ_CP022295.1 | Nocardioides aromaticivorans |
| 305 | 1589103 | 1589234 | + | NZ_CP048649.1 | Aminipila butyrica |
| 306 | 6044520 | 6044672 | - | NZ_CP015318.1 | Mesorhizobium amorphae CCNWGS0123 |
| 307 | 2271014 | 2271166 | - | NZ_CP031421.1 | Microbacterium oleivorans |
| 308 | 570342 | 570488 | - | NZ_CP012661.1 | Defluviimonas alba |
| 309 | 1985051 | 1985188 | - | NZ_CP038256.1 | Microbacterium sediminis |
| 310 | 3027320 | 3027442 | - | NZ_CP054836.1 | Oricola thermophila |
| 311 | 2129322 | 2129468 | + | NZ_AP019312.1 | Chromobacterium haemolyticum |
| 312 | 214947 | 215072 | + | NZ_CP030918.1 | Paracoccus suum |
| 313 | 1606050 | 1606202 | + | NC_014844.1 | Pseudodesulfovibrio aespoeensis Aspo-2 |
| 314 | 2078162 | 2078314 | - | NZ_LR214441.1 | Tessaracoccus lapidicaptus |
| 315 | 2211297 | 2211434 | + | NZ_CP019699.1 | Novibacillus thermophilus |
| 316 | 3926947 | 3927111 | + | NZ_CP029451.1 | Sinorhizobium fredii CCBAU 25509 |
| 317 | 265655 | 265786 | + | NC_020059.1 | Rhizobium tropici CIAT 899 |
| 318 | 2329729 | 2329872 | - | NZ_CP029256.1 | Christensenella minuta |
| 319 | 316776 | 316907 | + | NZ_CP032694.1 | Rhizobium jaguaris |
| 320 | 6986856 | 6987023 | - | NZ_CP034687.1 | Streptomyces griseoviridis |
| 321 | 743290 | 743448 | + | NZ_CP064760.1 | Microbacterium schleiferi |
| 322 | 588643 | 588804 | - | NZ_CP018171.1 | Mesorhizobium oceanicum |
| 323 | 2135654 | 2135785 | - | NZ_CP058670.1 | Chryseoglobus indicus |
| 324 | 829388 | 829516 | - | NZ_CP012908.1 | Ketogulonicigenium vulgare |
| 325 | 4985710 | 4985832 | - | NZ_CP046904.1 | Massilia flava |
| 326 | 266065 | 266190 | - | NZ_CP042261.1 | Qingshengfaniella alkalisoli |
| 327 | 120052 | 120216 | + | NZ_CP013107.1 | Sinorhizobium americanum |
| 328 | 3431603 | 3431758 | + | NZ_CP034909.1 | Ensifer alkalisoli |
| 329 | 3442422 | 3442586 | + | NZ_CP023067.1 | Ensifer sojae CCBAU 05684 |
| 330 | 829304 | 829453 | - | NZ_CP024411.1 | Mesoplasma entomophilum |
| 331 | 4019166 | 4019312 | + | NZ_CP029495.1 | Chromobacterium phragmitis |
| 332 | 962075 | 962221 | + | NZ_CP044232.1 | Microbacterium lushaniae |
| 333 | 3106060 | 3106230 | - | NZ_CP044060.1 | Aeromonas veronii |
| 334 | 994078 | 994224 | + | NZ_CP038266.1 | Microbacterium wangchenii |
| 335 | 3286699 | 3286863 | + | NZ_CP061202.1 | Rhodobacter capsulatus |
| 336 | 3015776 | 3015937 | + | NZ_CP032125.1 | Profundibacter amoris |
| 337 | 1795733 | 1795879 | + | NZ_CP047241.1 | Aquitalea denitrificans |
| 338 | 541164 | 541295 | - | NZ_CP012404.1 | Azospirillum thiophilum |
| 339 | 2542858 | 2543022 | + | NZ_CP032624.1 | Gryllotalpicola protaetiae |
| 340 | 3011198 | 3011371 | - | NZ_CP047180.1 | Rathayibacter festucae |
| 341 | 690075 | 690233 | + | NZ_CP016282.1 | Cryobacterium arcticum |
| 342 | 1915930 | 1916067 | + | NC_008148.1 | Rubrobacter xylanophilus DSM 9941 |
| 343 | 606212 | 606364 | - | NZ_CP023668.1 | Mesoplasma lactucae ATCC 49193 |
| 344 | 1690986 | 1691108 | - | NZ_CP028324.1 | Massilia armeniaca |
| 345 | 1744309 | 1744467 | - | NZ_CP030033.1 | Cryobacterium soli |
| 346 | 6140078 | 6140200 | - | NZ_CP040017.1 | Massilia umbonata |
| 347 | 5219513 | 5219635 | - | NZ_CP041185.1 | Janthinobacterium tructae |
| 348 | 1372700 | 1372843 | - | NZ_CP048832.1 | Janthinobacterium lividum |
| 349 | 1354091 | 1354213 | - | NZ_CP023422.1 | Janthinobacterium svalbardensis |
| 350 | 2865732 | 2865872 | + | NZ_CP015235.1 | Rhodococcus fascians D188 |
| 351 | 460241 | 460399 | - | NZ_CP012160.1 | Octadecabacter temperatus |
| 352 | 4785421 | 4785570 | + | NZ_HG322949.1 | Janthinobacterium agaricidamnosum NBRC 102515 = DSM 9628 |
| 353 | 88332 | 88475 | + | NZ_CP025543.1 | Spiroplasma monobiae MQ-1 |
| 354 | 207158 | 207289 | - | NZ_CP029833.1 | Azospirillum ramasamyi |
| 355 | 1848952 | 1849074 | - | NZ_CP024608.1 | Massilia violaceinigra |
| 356 | 2431847 | 2432002 | - | NZ_CP031425.1 | Microbacterium foliorum |
| 357 | 3029578 | 3029760 | + | NZ_CP054599.1 | Sulfitobacter pseudonitzschiae |
| 358 | 1543442 | 1543588 | - | NZ_CP043473.1 | Chromobacterium paludis |
| 359 | 2577614 | 2577760 | - | NZ_CP040709.1 | Inhella inkyongensis |
| 360 | 2099240 | 2099395 | - | NZ_CP028913.1 | Agromyces badenianii |
| 361 | 5665719 | 5665856 | + | NZ_CP036401.1 | Massilia albidiflava |
| 362 | 1954221 | 1954367 | - | NZ_CP028129.1 | Rathayibacter rathayi |
| 363 | 1903971 | 1904132 | + | NZ_CP032695.1 | Rhizobium jaguaris |
| 364 | 2287601 | 2287759 | - | NZ_CP047186.1 | Rathayibacter tanaceti |
| 365 | 2259902 | 2260069 | - | NZ_CP015515.1 | Rathayibacter tritici |
| 366 | 250332 | 250499 | + | NZ_CP013532.1 | Rhizobium phaseoli |
| 367 | 1863485 | 1863637 | - | NZ_CP039543.1 | Desulfovibrio marinus |
| 368 | 953149 | 953295 | - | NZ_CP049241.1 | Rhizobium pseudoryzae |
| 369 | 396609 | 396764 | + | NZ_CP004372.1 | Roseibacterium elongatum DSM 19469 |
| 370 | 250545 | 250712 | + | NZ_CP071604.1 | Rhizobium binae |
| 371 | 121524 | 121664 | + | NZ_LR723670.1 | Pseudorhizobium flavum |
| 372 | 789540 | 789701 | + | NZ_CP011368.1 | Mycoplasmopsis canis |
| 373 | 217903 | 218070 | + | NZ_CP006877.1 | Rhizobium gallicum bv. gallicum R602sp |
| 374 | 771087 | 771254 | + | NZ_CP049250.1 | Rhizobium rhizoryzae |
| 375 | 1794720 | 1794863 | + | NZ_CP041636.1 | Ferrovibrio terrae |
| 376 | 201920 | 202087 | + | NZ_CP071612.1 | Rhizobium bangladeshense |
| 377 | 2528755 | 2528889 | - | NZ_CP071883.1 | Curtobacterium flaccumfaciens pv. flaccumfaciens |
| 378 | 203486 | 203653 | + | NZ_CP020906.1 | Rhizobium etli |
| 379 | 204395 | 204562 | + | NZ_CP013500.1 | Rhizobium esperanzae |
| 380 | 5187488 | 5187610 | - | NZ_CP019038.1 | Massilia putida |
| 381 | 4398194 | 4398337 | + | NZ_CP034998.1 | Rhizobium acidisoli |
| 382 | 241288 | 241437 | + | NZ_CP019044.1 | Salaquimonas pukyongi |
| 383 | 2078894 | 2079037 | - | NZ_CP048632.1 | Rhizobium oryzihabitans |
| 384 | 2623575 | 2623718 | + | NZ_CP053856.1 | Rhizobium pusense |
| 385 | 1270297 | 1270458 | + | NZ_CP031422.1 | Microbacterium oxydans |
| 386 | 2736812 | 2736979 | + | NZ_CP061003.1 | Agrobacterium tumefaciens |
| 387 | 392919 | 393077 | - | NC_003911.12 | Ruegeria pomeroyi DSS-3 |
| 388 | 1796343 | 1796504 | + | NZ_CP042430.1 | Baekduia soli |
| 389 | 4126858 | 4127025 | - | NZ_CP054027.1 | Rhizobium hidalgonense |
| 390 | 736557 | 736685 | - | NZ_CP059674.1 | Mycoplasma tullyi |
| 391 | 2023045 | 2023212 | + | NZ_CP071454.1 | Rhizobium lentis |
| 392 | 2460984 | 2461151 | - | NZ_CP054021.1 | Rhizobium indicum |
| 393 | 269901 | 270068 | + | NZ_CP071678.1 | Rhizobium ruizarguesonis |
| 394 | 2275171 | 2275329 | + | NZ_CP045871.1 | Litoricola lipolytica |
| 395 | 1810374 | 1810520 | + | NZ_CP032630.1 | Protaetiibacter intestinalis |
| 396 | 2723914 | 2724036 | + | NZ_CP031115.1 | Rubrobacter indicoceani |
| 397 | 3337325 | 3337471 | - | NZ_CP059896.1 | Ciceribacter thiooxidans |
| 398 | 803867 | 804010 | - | NZ_CP010803.1 | Martelella endophytica |
| 399 | 3618854 | 3619000 | + | NZ_CP046908.1 | Stappia indica |
| 400 | 115380 | 115523 | - | NZ_CP020330.1 | Martelella mediterranea DSM 17316 |
| 401 | 166452 | 166583 | - | NZ_CP054617.1 | Azospirillum oryzae |
| 402 | 194638 | 194787 | - | NZ_CP024333.1 | Borrelia miyamotoi |
| 403 | 4492522 | 4492653 | + | NZ_HG938353.1 | Neorhizobium galegae bv. orientalis str. HAMBI 540 |
| 404 | 566709 | 566855 | + | NZ_CP035708.1 | Sphaerotilus natans subsp. sulfidivorans |
| 405 | 1833071 | 1833193 | - | NZ_CP017147.1 | Bosea vaviloviae |
| 406 | 3199083 | 3199217 | - | NC_015514.1 | Cellulomonas fimi ATCC 484 |
| 407 | 3985039 | 3985197 | + | NZ_CP015421.1 | Rhodovulum sulfidophilum |
| 408 | 1944842 | 1944985 | + | NZ_CP035510.1 | Haematobacter massiliensis |
| 409 | 1463633 | 1463761 | - | NZ_CP022603.1 | [Ochrobactrum] quorumnocens |
| 410 | 710534 | 710683 | + | NZ_CP013704.1 | Borrelia anserina Es |
| 411 | 743138 | 743266 | - | NC_004432.1 | Mycoplasma penetrans HF-2 |
| 412 | 3072123 | 3072278 | - | NZ_CP021330.1 | Maritalea myrionectae |
| 413 | 714049 | 714186 | + | NC_015921.1 | Borreliella bissettii DN127 |
| 414 | 442816 | 442977 | + | NC_017958.1 | Tistrella mobilis KA081020-065 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_AP019822.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02653.18 | 0.94 | 354 | 1019.5 | same-strand | Branched-chain amino acid transport system / permease component |
| 2 | PF02608.16 | 0.82 | 311 | 1495 | same-strand | ABC transporter substrate-binding protein PnrA-like |
++ More..