Result : EXP03845
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP03845 |
| NCBI Accession ID | |
| Organism | Clostridium |
| Left | |
| Right | |
| Strand | |
| Nucleotide Sequence | TTGAGGGGTCTCTGGGCTGATATGCGAAAAAAGACCATTTGTATGCTTGCAGTAGCCCTGCTGATGATGGGCCTCGGCCTGTGGCGGGGCGAGGGGGCGACGGTCCTCTCCAAGGGGATCAATCTGTGCATGGAGTGTGTGGGCATTGGCTAA |
| Sequence | MRGLWADMRKKTICMLAVALLMMGLGLWRGEGATVLSKGINLCMECVGIG |
| Source of smORF | Metagenomic Ribo-seq |
| Function | |
| Pubmed ID | 32601270 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 50 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1599700 | 1599831 | - | NZ_CP034413.2 | Dysosmobacter welbionis |
| 2 | 1835872 | 1836009 | + | NZ_CP030777.1 | Faecalibacterium prausnitzii |
| 3 | 245481 | 245615 | + | NC_010001.1 | Lachnoclostridium phytofermentans ISDg |
| 4 | 4669597 | 4669737 | - | NZ_CP039126.1 | Blautia producta |
| 5 | 379527 | 379667 | + | NZ_CP027002.1 | [Ruminococcus] gnavus ATCC 29149 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_010001.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00578.23 | 1.0 | 5 | 882 | same-strand | AhpC/TSA family |
| 2 | PF08534.12 | 1.0 | 5 | 882 | same-strand | Redoxin |
| 3 | PF13905.8 | 1.0 | 5 | 882 | same-strand | Thioredoxin-like |
| 4 | PF12801.9 | 1.0 | 5 | -7 | same-strand | 4Fe-4S binding domain |
| 5 | PF00037.29 | 1.0 | 5 | -7 | same-strand | 4Fe-4S binding domain |
| 6 | PF00072.26 | 1.0 | 5 | 156 | opposite-strand | Response regulator receiver domain |
| 7 | PF00486.30 | 1.0 | 5 | 156 | opposite-strand | Transcriptional regulatory protein, C terminal |
| 8 | PF02518.28 | 1.0 | 5 | 830 | opposite-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
| 9 | PF00512.27 | 1.0 | 5 | 830 | opposite-strand | His Kinase A (phospho-acceptor) domain |
| 10 | PF00672.27 | 1.0 | 5 | 830 | opposite-strand | HAMP domain |
| 11 | PF12838.9 | 0.8 | 4 | -7.0 | same-strand | 4Fe-4S dicluster domain |
| 12 | PF14501.8 | 0.6 | 3 | 782 | opposite-strand | GHKL domain |
| 13 | PF13187.8 | 0.6 | 3 | -7 | same-strand | 4Fe-4S dicluster domain |
++ More..