Result : EXP03777
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP03777 |
| NCBI Accession ID | |
| Organism | Escherichia |
| Left | |
| Right | |
| Strand | |
| Nucleotide Sequence | ATGGATATTGCTTCTGATATTGTCCGGCTGGACAATGTTACCGATAACAGTTACCCGTAA |
| Sequence | MDIASDIVRLDNVTDNSYP |
| Source of smORF | Metagenomic Ribo-seq |
| Function | |
| Pubmed ID | 32601270 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 19 |
++ More..
| Conservation Analysis |
No. of Species: 45
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4297008 | 4297067 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 3577626 | 3577685 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 283715 | 283774 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 4 | 3541294 | 3541353 | - | NZ_AP014857.1 | Escherichia albertii |
| 5 | 3550273 | 3550332 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 6 | 3723966 | 3724025 | + | NZ_CP038469.1 | Citrobacter tructae |
| 7 | 2490769 | 2490828 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 8 | 2359978 | 2360037 | - | NZ_CP033744.1 | Citrobacter freundii |
| 9 | 2714364 | 2714423 | + | NZ_CP044098.1 | Citrobacter portucalensis |
| 10 | 132954 | 133013 | - | NZ_CP045205.1 | Citrobacter telavivensis |
| 11 | 1555798 | 1555857 | + | NZ_LT556085.1 | Citrobacter amalonaticus |
| 12 | 4463291 | 4463350 | - | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 13 | 339947 | 340006 | + | NZ_CP054254.1 | Klebsiella variicola |
| 14 | 4960718 | 4960777 | - | NC_016845.1 | Klebsiella pneumoniae subsp. pneumoniae HS11286 |
| 15 | 331247 | 331306 | + | NZ_CP065838.1 | Klebsiella quasipneumoniae |
| 16 | 4073577 | 4073636 | - | NZ_LR134340.1 | Escherichia marmotae |
| 17 | 4633345 | 4633404 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 18 | 4550016 | 4550075 | - | NZ_CP063425.1 | Kosakonia pseudosacchari |
| 19 | 2797687 | 2797746 | - | NZ_CP016337.1 | Kosakonia sacchari |
| 20 | 4976420 | 4976479 | - | NZ_CP015113.1 | Kosakonia radicincitans |
| 21 | 1548541 | 1548600 | - | NZ_CP053416.1 | Salmonella bongori |
| 22 | 4420599 | 4420658 | - | NC_015968.1 | Enterobacter soli |
| 23 | 323484 | 323543 | + | NZ_LR134475.1 | Klebsiella aerogenes |
| 24 | 350402 | 350461 | + | NZ_CP014007.2 | Kosakonia oryzae |
| 25 | 442648 | 442707 | + | NZ_CP036175.1 | Klebsiella huaxiensis |
| 26 | 422484 | 422543 | + | NZ_CP060111.1 | Klebsiella michiganensis |
| 27 | 326094 | 326153 | + | NZ_CP043318.1 | Enterobacter chengduensis |
| 28 | 2956869 | 2956928 | - | NZ_CP017279.1 | Enterobacter ludwigii |
| 29 | 4500679 | 4500738 | - | NZ_CP009756.1 | Enterobacter cloacae |
| 30 | 2292210 | 2292269 | - | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
| 31 | 315083 | 315142 | + | NZ_CP017184.1 | Enterobacter roggenkampii |
| 32 | 313485 | 313544 | + | NZ_CP027986.1 | Enterobacter sichuanensis |
| 33 | 299144 | 299203 | + | NZ_AP022508.1 | Enterobacter bugandensis |
| 34 | 3101516 | 3101575 | - | NZ_CP023529.1 | Lelliottia amnigena |
| 35 | 2135851 | 2135910 | - | NZ_AP019007.1 | Enterobacter oligotrophicus |
| 36 | 2012662 | 2012721 | + | NZ_CP042941.1 | Atlantibacter hermannii |
| 37 | 220412 | 220471 | + | NC_017910.1 | Shimwellia blattae DSM 4481 = NBRC 105725 |
| 38 | 320525 | 320584 | + | NZ_CP035129.1 | Kosakonia cowanii |
| 39 | 345860 | 345919 | + | NZ_CP013990.1 | Leclercia adecarboxylata |
| 40 | 3946410 | 3946469 | + | NZ_CP045769.1 | Enterobacter cancerogenus |
| 41 | 802682 | 802741 | - | NZ_CP040428.1 | Jejubacter calystegiae |
| 42 | 280493 | 280552 | + | NZ_CP054058.1 | Scandinavium goeteborgense |
| 43 | 356162 | 356221 | + | NZ_CP045845.1 | Kluyvera intermedia |
| 44 | 868836 | 868895 | + | NZ_CP051548.1 | Phytobacter diazotrophicus |
| 45 | 5030942 | 5031001 | + | NZ_CP011602.1 | Phytobacter ursingii |
| 46 | 131660 | 131719 | + | NZ_AP023184.1 | Buttiauxella agrestis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02447.18 | 1.0 | 45 | 565.5 | same-strand | GntP family permease |
| 2 | PF03600.18 | 1.0 | 45 | 565.5 | same-strand | Citrate transporter |
| 3 | PF13726.8 | 0.71 | 32 | 565 | same-strand | Na+-H+ antiporter family |
| 4 | PF01202.24 | 1.0 | 45 | 33.5 | same-strand | Shikimate kinase |
| 5 | PF13671.8 | 1.0 | 45 | 33.5 | same-strand | AAA domain |
| 6 | PF13238.8 | 1.0 | 45 | 33.5 | same-strand | AAA domain |
| 7 | PF00532.23 | 1.0 | 45 | 46.0 | same-strand | Periplasmic binding proteins and sugar binding domain of LacI family |
| 8 | PF13377.8 | 1.0 | 45 | 46.0 | same-strand | Periplasmic binding protein-like domain |
| 9 | PF00356.23 | 0.98 | 44 | 46 | same-strand | Bacterial regulatory proteins, lacI family |
| 10 | PF13407.8 | 1.0 | 45 | 46 | same-strand | Periplasmic binding protein domain |
| 11 | PF02678.18 | 1.0 | 45 | 1146.0 | same-strand | Pirin |
| 12 | PF17954.3 | 1.0 | 45 | 1146.0 | same-strand | Quercetinase C-terminal cupin domain |
| 13 | PF07883.13 | 1.0 | 45 | 1146.0 | same-strand | Cupin domain |
| 14 | PF02894.19 | 0.93 | 42 | 1964 | same-strand | Oxidoreductase family, C-terminal alpha/beta domain |
| 15 | PF01408.24 | 0.93 | 42 | 1964 | same-strand | Oxidoreductase family, NAD-binding Rossmann fold |
| 16 | PF00583.27 | 0.84 | 38 | 3440 | opposite-strand | Acetyltransferase (GNAT) family |
| 17 | PF13420.9 | 0.87 | 39 | 3442.0 | opposite-strand | Acetyltransferase (GNAT) domain |
| 18 | PF13302.9 | 0.89 | 40 | 3440 | opposite-strand | Acetyltransferase (GNAT) domain |
| 19 | PF13508.9 | 0.87 | 39 | 3442.0 | opposite-strand | Acetyltransferase (GNAT) domain |
| 20 | PF02922.20 | 0.64 | 29 | 4164 | same-strand | Carbohydrate-binding module 48 (Isoamylase N-terminal domain) |
| 21 | PF02806.20 | 0.64 | 29 | 4123 | same-strand | Alpha amylase, C-terminal all-beta domain |
| 22 | PF02774.20 | 0.78 | 35 | 2783 | same-strand | Semialdehyde dehydrogenase, dimerisation domain |
| 23 | PF01118.26 | 0.78 | 35 | 2783 | same-strand | Semialdehyde dehydrogenase, NAD binding domain |
| 24 | PF01914.19 | 0.64 | 29 | 2034 | opposite-strand | MarC family integral membrane protein |
++ More..