Result : EXP03740
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP03740 |
| NCBI Accession ID | |
| Organism | Escherichia,Shigella |
| Left | |
| Right | |
| Strand | |
| Nucleotide Sequence | ATGAAAAGTGTGGCAAACCGTAATCTGCAAGGCGTGCCGCTGGACAGCGATGGCGACGCTGGCGATTATTCTGTTTGGTAA |
| Sequence | MKSVANRNLQGVPLDSDGDAGDYSVW |
| Source of smORF | Metagenomic Ribo-seq |
| Function | |
| Pubmed ID | 32601270 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 26 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3056029 | 3056106 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 2 | 4026891 | 4026971 | - | NC_013716.1 | Citrobacter rodentium ICC168 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP057657.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00175.23 | 1.0 | 2 | 3891.0 | opposite-strand | Oxidoreductase NAD-binding domain |
| 2 | PF03320.15 | 1.0 | 2 | 2766.0 | opposite-strand | Bacterial fructose-1,6-bisphosphatase, glpX-encoded |
| 3 | PF00370.23 | 1.0 | 2 | 1130.0 | opposite-strand | FGGY family of carbohydrate kinases, N-terminal domain |
| 4 | PF02782.18 | 1.0 | 2 | 1130.0 | opposite-strand | FGGY family of carbohydrate kinases, C-terminal domain |
| 5 | PF00230.22 | 1.0 | 2 | 262.5 | opposite-strand | Major intrinsic protein |
| 6 | PF06005.14 | 1.0 | 2 | 79.0 | same-strand | Cell division protein ZapB |
| 7 | PF03737.17 | 1.0 | 2 | 1130.0 | opposite-strand | Aldolase/RraA |
| 8 | PF01040.20 | 1.0 | 2 | 1707.5 | opposite-strand | UbiA prenyltransferase family |
++ More..